You are here

Keene, Jack Donald

Overview:

The Keene Laboratory has a long-term interest in the structure and function of viral and mammalian genomes. Having determined the first genomic sequences for rabies, Ebola, Marburg and vesicular stomatitis virus, and discerned the origins of defective interfering viruses, interests shifted to the cloning of six human genes involved in autoimmune reactivity. This resulted in the identification of numerous autoimmune RRM-type RNA-binding proteins the discovery of the RRM, and the RNA targets to which they bind. The current interests of the lab surround the functions of the human RRM-ELAV/Hu proteins that are bound to a subset of cellular mRNAs involved in growth regulation neuronal plasticiyt and cancer. The laboratory demonstrated that ELAV/Hu proteins bind and regulate the expression of early response gene transcripts such as those encoding the protooncogene and cytokine proteins.

In addition, it was shown that while stabilizing these mRNAs and/or activating their translation, the ELAV/Hu proteins participate in cellular , differentiation and carcinogenesis. More recently, the laboratory has examined dozens of RNA-binding proteins in order to identify large numbers of structurally
and/or functionally related mRNAs that cluster in vivo based upon their binding to these proteins. This has been termed ribonomics because it involves parallel analysis of mRNA subsets en masse based upon their presence in messenger ribonucleoprotein complexes. This new approach to functional genomics is being applied to virus-infected cells, tumors and cells treated with various agents. Ribonomics has led to the identification of mRNA clusters that are posttranscriptionally regulated, and represent the organizational state of genetic information between the genome and the proteome. Dr. Keen has propsed the existence of post-transcriptional operons based upon the association of structurally and functionally-linked mRNAs in vivo.

Positions:

James B. Duke Professor of Molecular Genetics and Microbiology

Molecular Genetics and Microbiology
School of Medicine

Professor of Molecular Genetics and Microbiology

Molecular Genetics and Microbiology
School of Medicine

Associate Professor in Medicine

Medicine, Rheumatology and Immunology
School of Medicine

Member of the Duke Cancer Institute

Duke Cancer Institute
School of Medicine

Education:

Ph.D. 1974

Ph.D. — University of Washington

Grants:

Transfusion Medicine and Hematology

Administered By
Medicine, Hematology
AwardedBy
National Institutes of Health
Role
Preceptor
Start Date
July 01, 1975
End Date
June 30, 2021

Interdisciplinary Research Training Program in AIDS

Administered By
Medicine, Infectious Diseases
AwardedBy
National Institutes of Health
Role
Mentor
Start Date
September 01, 2010
End Date
August 31, 2020

Viral Oncology Training Grant

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Participating Faculty Member
Start Date
July 01, 1980
End Date
June 30, 2019

Post-transcriptional RNA regulation in mammalian neural stem cells

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Consultant
Start Date
April 01, 2017
End Date
March 31, 2019

Mechanisms of neural progenitor division in the developing brain

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Advisor
Start Date
June 01, 2013
End Date
May 31, 2018

Targeting Translation Control in Malignant Glioma

Administered By
Neurosurgery, Neuro-Oncology
AwardedBy
National Institutes of Health
Role
Collaborator
Start Date
January 17, 2007
End Date
May 31, 2018

Post-transcriptional coordination by HuR and microRNAs during tumorigenesis

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
March 01, 2014
End Date
February 28, 2017

RNA Dynamics of Transient Macromolecular Complexes in Cancer Cells

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
September 01, 2011
End Date
January 31, 2017

Clinical Oncology Research Career Development Program

Administered By
Surgery, Surgical Sciences
AwardedBy
National Institutes of Health
Role
Mentor
Start Date
September 29, 2009
End Date
July 31, 2015

Regulation of Germ Cell Pluripotency Through The RNA-Binding Protein, DND1

Administered By
Cell Biology
AwardedBy
National Institutes of Health
Role
Collaborator
Start Date
August 01, 2010
End Date
July 31, 2014

RNA Operons In Coordinated Gene Expression and Horizontal Transfer

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Science Foundation
Role
Principal Investigator
Start Date
April 01, 2009
End Date
March 31, 2012

Mucin Gene Regulation by Elastase and Oxidants

Administered By
Pediatrics, Pulmonary and Sleep Medicine
AwardedBy
National Institutes of Health
Role
Consultant
Start Date
September 15, 2005
End Date
July 31, 2010

Development And Persistence Of Immunity In SCID Chimeras

Administered By
Pediatrics, Allergy and Immunology
AwardedBy
National Institutes of Health
Role
Consultant
Start Date
December 01, 1998
End Date
April 30, 2010

Posttranscriptional regulation of the Wnt pathway by HuR and microRNAs

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
April 01, 2007
End Date
March 31, 2009

Endothelial Cell Molecular Alterations in Cancer

Administered By
Pathology
AwardedBy
National Institutes of Health
Role
Co-Principal Investigator
Start Date
August 23, 2002
End Date
July 31, 2008

Posttranscriptional Gene Regulation in T Cell Activation

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
July 01, 2000
End Date
May 31, 2007

Stem Cell Mechanism in the Murine Germline

Administered By
Cell Biology
AwardedBy
National Institutes of Health
Role
Co Investigator
Start Date
April 01, 2002
End Date
August 31, 2006

Function of Mammalian ELAV RNA-Binding Proteins

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
August 01, 1999
End Date
May 31, 2006

Regulation of Mucin Gene Expression by Elastase

Administered By
Pediatrics, Pulmonary and Sleep Medicine
AwardedBy
National Institutes of Health
Role
Consultant
Start Date
August 05, 2000
End Date
July 31, 2005

Cancer Center Core Support Grant

Administered By
Medicine, Medical Oncology
AwardedBy
National Institutes of Health
Role
Co-Principal Investigator
Start Date
September 01, 1976
End Date
December 31, 1998

Comprehensive Cancer Center Core Support Grant

Administered By
Medicine, Medical Oncology
AwardedBy
National Institutes of Health
Role
Co-Principal Investigator
Start Date
September 01, 1976
End Date
December 31, 1998

Comprehensive Cancer Center Core Support Grant

Administered By
Medicine, Medical Oncology
AwardedBy
National Institutes of Health
Role
Co-Principal Investigator
Start Date
September 01, 1976
End Date
December 31, 1998

Determinants Of Specificity In Protein-Rna Interactions

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
April 01, 1993
End Date
April 30, 1998

Peptide Immunogens For Mucosal & Systemic Hiv Vaccines Nat

Administered By
Medicine, Rheumatology and Immunology
AwardedBy
National Institutes of Health
Role
Co-Principal Investigator
Start Date
December 15, 1993
End Date
November 30, 1997

Molecular Biology Of The Ro-Rnp Autoantigen

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Co-Principal Investigator
Start Date
September 01, 1993
End Date
August 31, 1994

Replicative Mechanisms Of The Negative Strand Viruses

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
April 01, 1992
End Date
March 31, 1993

Replicative Mechanisms Of The Negative Strand Viruses

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
April 01, 1991
End Date
March 31, 1993

Replicative Mechanisms Of The Negative Strant Viruses

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
April 01, 1990
End Date
March 31, 1993

Replicative Mechnaisms Of The Negative Strand Viruses

Administered By
Molecular Genetics and Microbiology
AwardedBy
National Institutes of Health
Role
Principal Investigator
Start Date
April 01, 1986
End Date
March 01, 1988
Show More

Awards:

Honorary Member. The LARP (La-And-Related-Protein) Society.

Type
International
Awarded By
The LARP (La-And-Related-Protein) Society
Date
January 01, 2014

AAAS Fellow. The American Association for the Advancement of Science.

Type
National
Awarded By
The American Association for the Advancement of Science
Date
January 01, 2010

Elected Member. The Henry Kunkel Honorary Society.

Type
National
Awarded By
The Henry Kunkel Honorary Society
Date
January 01, 2000

Fellow of the American Academy of Microbiology. American Society of Microbiology.

Type
National
Awarded By
American Society of Microbiology
Date
January 01, 1991

Pew Scholar in the Biomedical Sciences. The Pew Charitable Trusts.

Type
National
Awarded By
The Pew Charitable Trusts
Date
January 01, 1985

Publications:

Analysis of post-transcriptional regulation during cancer progression using a donor-derived isogenic model of tumorigenesis.

Post-transcriptional regulation of gene expression by RNA binding proteins (RBPs) and non-coding RNAs plays an important role in global gene expression. Many post-transcriptional regulators are misexpressed and misregulated in cancers, resulting in altered programs of protein biosynthesis that can drive tumor progression. While comparative studies of several RBPs and microRNAs expressed in various cancer types have been reported, a model system that can be used to quantify RBP regulation and functional outcomes during the initiation and early stages of tumorigenesis is lacking. It was previously demonstrated that oncogenic transformation of normal human cells can be induced by expressing hTERT, p53DD, cyclin D1, CDK4R24C, C-MYCT58A and H-RASG12V. Here we describe a user-friendly method for generating this genetically defined model of step-wise tumorigenesis beginning with normal donor-derived human cells. This method immortalizes a donor's normal cells in about a week, reducing the chances of senescence. The entire stable system can be established in less than 12weeks. We then demonstrate the utility of such a system in elucidating the expression of multiple RBPs at an early step of tumor formation. We identify significant changes in the expression levels of transcripts encoding RBPs prior to transformation, suggesting that our described donor-derived isogenic system can provide insight about post-transcriptional regulation during the earliest stages of tumorigenesis in the context of diverse genetic backgrounds.

Authors
Bisogno, LS; Keene, JD
MLA Citation
Bisogno, LS, and Keene, JD. "Analysis of post-transcriptional regulation during cancer progression using a donor-derived isogenic model of tumorigenesis." Methods (San Diego, Calif.) 126 (August 2017): 193-200.
PMID
28529064
Source
epmc
Published In
Methods
Volume
126
Publish Date
2017
Start Page
193
End Page
200
DOI
10.1016/j.ymeth.2017.05.012

DO-RIP-seq to quantify RNA binding sites transcriptome-wide.

Post-transcriptional processes orchestrate gene expression through dynamic protein-RNA interactions. These interactions occur at specific sites determined by RNA sequence, secondary structure, or nucleotide modifications. Methods have been developed either to quantify binding of whole transcripts or to identify the binding sites, but there is none proven to quantify binding at both the whole transcript and binding site levels. Here we describe digestion optimized RNA immunoprecipitation with deep sequencing (DO-RIP-seq) as a method that quantitates at the whole transcript target (RIP-Seq-Like or RSL) level and at the binding site level (BSL) using continuous metrics. DO-RIP-seq methodology was developed using the RBP HuR/ELAVL1 as a test case (Nicholson et al., 2016). DO-RIP-seq employs treatment of cell lysates with a nuclease under optimized conditions to yield partially digested RNA fragments bound by RNA binding proteins, followed by immunoprecipitations that capture the digested RNA-protein complexes and assess non-specific or background interactions. Analyses of sequenced cDNA libraries made from the bound RNA fragments yielded two types of enrichment scores; one for RSL binding events and the other for BSL events (Nicholson et al., 2016). These analyses plus the extensive read coverage of DO-RIP-seq allows seamless integration of binding site and whole transcript information. Therefore, DO-RIP-seq is useful for quantifying RBP binding events that are regulated during dynamic biological processes.

Authors
Nicholson, CO; Friedersdorf, MB; Bisogno, LS; Keene, JD
MLA Citation
Nicholson, CO, Friedersdorf, MB, Bisogno, LS, and Keene, JD. "DO-RIP-seq to quantify RNA binding sites transcriptome-wide." Methods (San Diego, Calif.) 118-119 (April 2017): 16-23.
PMID
27840290
Source
epmc
Published In
Methods
Volume
118-119
Publish Date
2017
Start Page
16
End Page
23
DOI
10.1016/j.ymeth.2016.11.004

Functional coordination and HuR-mediated regulation of mRNA stability during T cell activation.

Global mRNA abundance depends on the balance of synthesis and decay of a population of mRNAs. To account for this balance during activation of T cells, we used metabolic labeling to quantify the contributions of RNA transcription and decay over a 4 h time course during activation of leukemia-derived Jurkat T cells. While prior studies suggested more than half of the changes in mRNA abundance were due to RNA stability, we found a smaller but more interesting population of mRNAs changed stability. These mRNAs clustered into functionally related subpopulations that included replicative histones, ribosomal biogenesis and cell motility functions. We then applied a novel analysis based on integrating global protein-RNA binding with concurrent changes in RNA stability at specific time points following activation. This analysis demonstrated robust stabilization of mRNAs by the HuR RNA-binding protein 4 h after activation. Our unexpected findings demonstrate that the temporal regulation of mRNA stability coordinates vital cellular pathways and is in part controlled by the HuR RNA binding protein in Jurkat T cells following activation.

Authors
Blackinton, JG; Keene, JD
MLA Citation
Blackinton, JG, and Keene, JD. "Functional coordination and HuR-mediated regulation of mRNA stability during T cell activation." Nucleic acids research 44.1 (January 2016): 426-436.
Website
http://hdl.handle.net/10161/15382
PMID
26490963
Source
epmc
Published In
Nucleic Acids Research
Volume
44
Issue
1
Publish Date
2016
Start Page
426
End Page
436
DOI
10.1093/nar/gkv1066

XRN1 stalling in the 5' UTR of Hepatitis C virus and Bovine Viral Diarrhea virus is associated with dysregulated host mRNA stability.

We demonstrate that both Hepatitis C virus (HCV) and Bovine Viral Diarrhea virus (BVDV) contain regions in their 5' UTRs that stall and repress the enzymatic activity of the cellular 5'-3' exoribonuclease XRN1, resulting in dramatic changes in the stability of cellular mRNAs. We used biochemical assays, virus infections, and transfection of the HCV and BVDV 5' untranslated regions in the absence of other viral gene products to directly demonstrate the existence and mechanism of this novel host-virus interaction. In the context of HCV infection, we observed globally increased stability of mRNAs resulting in significant increases in abundance of normally short-lived mRNAs encoding a variety of relevant oncogenes and angiogenesis factors. These findings suggest that non-coding regions from multiple genera of the Flaviviridae interfere with XRN1 and impact post-transcriptional processes, causing global dysregulation of cellular gene expression which may promote cell growth and pathogenesis.

Authors
Moon, SL; Blackinton, JG; Anderson, JR; Dozier, MK; Dodd, BJT; Keene, JD; Wilusz, CJ; Bradrick, SS; Wilusz, J
MLA Citation
Moon, SL, Blackinton, JG, Anderson, JR, Dozier, MK, Dodd, BJT, Keene, JD, Wilusz, CJ, Bradrick, SS, and Wilusz, J. "XRN1 stalling in the 5' UTR of Hepatitis C virus and Bovine Viral Diarrhea virus is associated with dysregulated host mRNA stability." PLoS pathogens 11.3 (March 6, 2015): e1004708-.
PMID
25747802
Source
epmc
Published In
PLoS pathogens
Volume
11
Issue
3
Publish Date
2015
Start Page
e1004708
DOI
10.1371/journal.ppat.1004708

Post-transcriptional RNA regulons affecting cell cycle and proliferation

© 2014 Elsevier Ltd. The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis.

Authors
Blackinton, JG; Keene, JD
MLA Citation
Blackinton, JG, and Keene, JD. "Post-transcriptional RNA regulons affecting cell cycle and proliferation." Seminars in Cell and Developmental Biology 34 (October 1, 2014): 44-54. (Review)
Source
scopus
Published In
Seminars in Cell and Developmental Biology
Volume
34
Publish Date
2014
Start Page
44
End Page
54
DOI
10.1016/j.semcdb.2014.05.014

Post-transcriptional RNA regulons affecting cell cycle and proliferation.

The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis.

Authors
Blackinton, JG; Keene, JD
MLA Citation
Blackinton, JG, and Keene, JD. "Post-transcriptional RNA regulons affecting cell cycle and proliferation." Seminars in cell & developmental biology 34 (October 2014): 44-54. (Review)
PMID
24882724
Source
epmc
Published In
Seminars in Cell and Developmental Biology
Volume
34
Publish Date
2014
Start Page
44
End Page
54
DOI
10.1016/j.semcdb.2014.05.014

Transcriptional and posttranscriptional regulation of cytokine gene expression in HIV-1 antigen-specific CD8+ T cells that mediate virus inhibition.

The ability of CD8+ T cells to effectively limit HIV-1 replication and block HIV-1 acquisition is determined by the capacity to rapidly respond to HIV-1 antigens. Understanding both the functional properties and regulation of an effective CD8+ response would enable better evaluation of T cell-directed vaccine strategies and may inform the design of new therapies. We assessed the antigen specificity, cytokine signature, and mechanisms that regulate antiviral gene expression in CD8+ T cells from a cohort of HIV-1-infected virus controllers (VCs) (<5,000 HIV-1 RNA copies/ml and CD4+ lymphocyte counts of >400 cells/μl) capable of soluble inhibition of HIV-1. Gag p24 and Nef CD8+ T cell-specific soluble virus inhibition was common among the VCs and correlated with substantial increases in the abundance of mRNAs encoding the antiviral cytokines macrophage inflammatory proteins MIP-1α, MIP-1αP (CCL3L1), and MIP-1β; granulocyte-macrophage colony-stimulating factor (GM-CSF); lymphotactin (XCL1); tumor necrosis factor receptor superfamily member 9 (TNFRSF9); and gamma interferon (IFN-γ). The induction of several of these mRNAs was driven through a coordinated response of both increased transcription and stabilization of mRNA, which together accounted for the observed increase in mRNA abundance. This coordinated response allows rapid and robust induction of mRNA messages that can enhance the CD8+ T cells' ability to inhibit virus upon antigen encounter.We show that mRNA stability, in addition to transcription, is key in regulating the direct anti-HIV-1 function of antigen-specific memory CD8+ T cells. Regulation at the level of RNA helps enable rapid recall of memory CD8+ T cell effector functions for HIV-1 inhibition. By uncovering and understanding the mechanisms employed by CD8+ T cell subsets with antigen-specific anti-HIV-1 activity, we can identify new strategies for comprehensive identification of other important antiviral genes. This will, in turn, enhance our ability to inhibit virus replication by informing both cure strategies and HIV-1 vaccine designs that aim to reduce transmission and can aid in blocking HIV-1 acquisition.

Authors
Payne, TL; Blackinton, J; Frisbee, A; Pickeral, J; Sawant, S; Vandergrift, NA; Freel, SA; Ferrari, G; Keene, JD; Tomaras, GD
MLA Citation
Payne, TL, Blackinton, J, Frisbee, A, Pickeral, J, Sawant, S, Vandergrift, NA, Freel, SA, Ferrari, G, Keene, JD, and Tomaras, GD. "Transcriptional and posttranscriptional regulation of cytokine gene expression in HIV-1 antigen-specific CD8+ T cells that mediate virus inhibition." Journal of virology 88.17 (September 2014): 9514-9528.
PMID
24899193
Source
epmc
Published In
Journal of virology
Volume
88
Issue
17
Publish Date
2014
Start Page
9514
End Page
9528
DOI
10.1128/jvi.00802-14

The globalization of messenger RNA regulation.

Authors
Keene, JD
MLA Citation
Keene, JD. "The globalization of messenger RNA regulation." National science review 1.2 (June 2014): 184-186.
PMID
28078165
Source
epmc
Published In
National science review
Volume
1
Issue
2
Publish Date
2014
Start Page
184
End Page
186
DOI
10.1093/nsr/nwu004

Advancing the functional utility of PAR-CLIP by quantifying background binding to mRNAs and lncRNAs.

BACKGROUND: Sequence specific RNA binding proteins are important regulators of gene expression. Several related crosslinking-based, high-throughput sequencing methods, including PAR-CLIP, have recently been developed to determine direct binding sites of global protein-RNA interactions. However, no studies have quantitatively addressed the contribution of background binding to datasets produced by these methods. RESULTS: We measured non-specific RNA background in PAR-CLIP data, demonstrating that covalently crosslinked background binding is common, reproducible and apparently universal among laboratories. We show that quantitative determination of background is essential for identifying targets of most RNA-binding proteins and can substantially improve motif analysis. We also demonstrate that by applying background correction to an RNA binding protein of unknown binding specificity, Caprin1, we can identify a previously unrecognized RNA recognition element not otherwise apparent in a PAR-CLIP study. CONCLUSIONS: Empirical background measurements of global RNA-protein crosslinking are a necessary addendum to other experimental controls, such as performing replicates, because covalently crosslinked background signals are reproducible and otherwise unavoidable. Recognizing and quantifying the contribution of background extends the utility of PAR-CLIP and can improve mechanistic understanding of protein-RNA specificity, protein-RNA affinity and protein-RNA association dynamics.

Authors
Friedersdorf, MB; Keene, JD
MLA Citation
Friedersdorf, MB, and Keene, JD. "Advancing the functional utility of PAR-CLIP by quantifying background binding to mRNAs and lncRNAs. (Published online)" Genome Biol 15.1 (January 7, 2014): R2-.
PMID
24393468
Source
pubmed
Published In
Genome Biology
Volume
15
Issue
1
Publish Date
2014
Start Page
R2
DOI
10.1186/gb-2014-15-1-r2

Mechanisms coordinating ELAV/Hu mRNA regulons.

The 5' and 3' untranslated regions (UTRs) of messenger RNAs (mRNAs) function as platforms that can determine the fate of each mRNA individually and in aggregate. Multiple mRNAs that encode proteins that are functionally related often interact with RNA-binding proteins (RBPs) and noncoding RNAs (ncRNAs) that coordinate their expression in time and space as RNA regulons within the ribonucleoprotein (RNP) infrastructure we term the ribonome. Recent ribonomic methods have emerged that can determine which mRNAs are bound and regulated by RBPs and ncRNAs, some of which act in combination to determine global outcomes. ELAV/Hu proteins bind to AU-rich elements (ARE) in mRNAs and regulate their stability from splicing to translation, and the ubiquitous HuR protein has been implicated in cancerous cell growth. Recent work is focused on mechanistic models of how ELAV/Hu proteins increase mRNA stability and translation by repressing microRNAs (miRs) and the RNA induced silencing complex (RISC) via ARE-based ribonucleosomes that may affect global functions of mRNA regulons.

Authors
Simone, LE; Keene, JD
MLA Citation
Simone, LE, and Keene, JD. "Mechanisms coordinating ELAV/Hu mRNA regulons." Curr Opin Genet Dev 23.1 (February 2013): 35-43. (Review)
PMID
23312841
Source
pubmed
Published In
Current Opinion in Genetics and Development
Volume
23
Issue
1
Publish Date
2013
Start Page
35
End Page
43
DOI
10.1016/j.gde.2012.12.006

Preface

Authors
Keene, JD
MLA Citation
Keene, JD. "Preface." January 1, 2013.
Source
scopus
Volume
768
Publish Date
2013
DOI
10.1007/978-1-4614-5107_5

Preface

Authors
Keene, JD
MLA Citation
Keene, JD. "Preface." Advances in Experimental Medicine and Biology 768 (2013): v-vi.
Source
scival
Published In
Advances in experimental medicine and biology
Volume
768
Publish Date
2013
Start Page
v
End Page
vi
DOI
10.1007/978-1-4614-5107-5

Mechanisms coordinating ELAV/Hu mRNA regulons

The 5' and 3' untranslated regions (UTRs) of messenger RNAs (mRNAs) function as platforms that can determine the fate of each mRNA individually and in aggregate. Multiple mRNAs that encode proteins that are functionally related often interact with RNA-binding proteins (RBPs) and noncoding RNAs (ncRNAs) that coordinate their expression in time and space as RNA regulons within the ribonucleoprotein (RNP) infrastructure we term the ribonome. Recent ribonomic methods have emerged that can determine which mRNAs are bound and regulated by RBPs and ncRNAs, some of which act in combination to determine global outcomes. ELAV/Hu proteins bind to AU-rich elements (ARE) in mRNAs and regulate their stability from splicing to translation, and the ubiquitous HuR protein has been implicated in cancerous cell growth. Recent work is focused on mechanistic models of how ELAV/Hu proteins increase mRNA stability and translation by repressing microRNAs (miRs) and the RNA induced silencing complex (RISC) via ARE-based ribonucleosomes that may affect global functions of mRNA regulons. © 2012 Elsevier Ltd.

Authors
Simone, LE; Keene, JD
MLA Citation
Simone, LE, and Keene, JD. "Mechanisms coordinating ELAV/Hu mRNA regulons." Current Opinion in Genetics and Development 23.1 (2013): 35-43.
Source
scival
Published In
Current Opinion in Genetics & Development
Volume
23
Issue
1
Publish Date
2013
Start Page
35
End Page
43
DOI
10.1016/j.gde.2012.12.006

Neuron-specific ELAV/Hu proteins suppress HuR mRNA during neuronal differentiation by alternative polyadenylation.

The ubiquitously expressed RNA-binding protein HuR increases the stability and translation of mRNAs encoding growth regulatory proteins that promote proliferation in a variety of cell types. However, the three neuron-specific ELAV/Hu proteins, HuB, HuC and HuD, while binding to the same types of mRNAs, are required instead for neuronal differentiation, and it becomes difficult to reconcile these contrary functions when all four Hu proteins are expressed in the same neuron. HuR mRNA exists as three alternatively polyadenylated variants, a 1.5-kb testes-specific mRNA isoform, a ubiquitous 2.4-kb isoform and a 6.0-kb isoform that we now show is induced during neuronal differentiation and appears to be neuron-specific. This 6.0-kb neuron-specific mRNA isoform is inherently less stable and produces less HuR protein than the ubiquitous 2.4-kb mRNA. Furthermore, we show that neuronal HuB, HuC and HuD, as well as HuR itself, can bind at the 2.4-kb mRNA polyadenylation site, and when overexpressed can affect alternative polyadenylation to generate an extended HuR 3'-UTR that is translationally suppressed. We propose that the regulation of HuR protein expression by alternative polyadenylation allows neurons to post-transcriptionally regulate mRNAs-encoding factors required for proliferation versus differentiation to facilitate neuronal differentiation.

Authors
Mansfield, KD; Keene, JD
MLA Citation
Mansfield, KD, and Keene, JD. "Neuron-specific ELAV/Hu proteins suppress HuR mRNA during neuronal differentiation by alternative polyadenylation." Nucleic Acids Research 40.6 (March 2012): 2734-2746.
PMID
22139917
Source
epmc
Published In
Nucleic Acids Research
Volume
40
Issue
6
Publish Date
2012
Start Page
2734
End Page
2746
DOI
10.1093/nar/gkr1114

PARalyzer: definition of RNA binding sites from PAR-CLIP short-read sequence data.

Crosslinking and immunoprecipitation (CLIP) protocols have made it possible to identify transcriptome-wide RNA-protein interaction sites. In particular, PAR-CLIP utilizes a photoactivatable nucleoside for more efficient crosslinking. We present an approach, centered on the novel PARalyzer tool, for mapping high-confidence sites from PAR-CLIP deep-sequencing data. We show that PARalyzer delineates sites with a high signal-to-noise ratio. Motif finding identifies the sequence preferences of RNA-binding proteins, as well as seed-matches for highly expressed microRNAs when profiling Argonaute proteins. Our study describes tailored analytical methods and provides guidelines for future efforts to utilize high-throughput sequencing in RNA biology. PARalyzer is available at http://www.genome.duke.edu/labs/ohler/research/PARalyzer/.

Authors
Corcoran, DL; Georgiev, S; Mukherjee, N; Gottwein, E; Skalsky, RL; Keene, JD; Ohler, U
MLA Citation
Corcoran, DL, Georgiev, S, Mukherjee, N, Gottwein, E, Skalsky, RL, Keene, JD, and Ohler, U. "PARalyzer: definition of RNA binding sites from PAR-CLIP short-read sequence data. (Published online)" Genome Biol 12.8 (August 18, 2011): R79-.
PMID
21851591
Source
pubmed
Published In
Genome Biology
Volume
12
Issue
8
Publish Date
2011
Start Page
R79
DOI
10.1186/gb-2011-12-8-r79

Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability.

RNA-binding proteins coordinate the fates of multiple RNAs, but the principles underlying these global interactions remain poorly understood. We elucidated regulatory mechanisms of the RNA-binding protein HuR, by integrating data from diverse high-throughput targeting technologies, specifically PAR-CLIP, RIP-chip, and whole-transcript expression profiling. The number of binding sites per transcript, degree of HuR association, and degree of HuR-dependent RNA stabilization were positively correlated. Pre-mRNA and mature mRNA containing both intronic and 3' UTR binding sites were more highly stabilized than transcripts with only 3' UTR or only intronic binding sites, suggesting that HuR couples pre-mRNA processing with mature mRNA stability. We also observed HuR-dependent splicing changes and substantial binding of HuR in polypyrimidine tracts of pre-mRNAs. Comparison of the spatial patterns surrounding HuR and miRNA binding sites provided functional evidence for HuR-dependent antagonism of proximal miRNA-mediated repression. We conclude that HuR coordinates gene expression outcomes at multiple interconnected steps of RNA processing.

Authors
Mukherjee, N; Corcoran, DL; Nusbaum, JD; Reid, DW; Georgiev, S; Hafner, M; Ascano, M; Tuschl, T; Ohler, U; Keene, JD
MLA Citation
Mukherjee, N, Corcoran, DL, Nusbaum, JD, Reid, DW, Georgiev, S, Hafner, M, Ascano, M, Tuschl, T, Ohler, U, and Keene, JD. "Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability." Mol Cell 43.3 (August 5, 2011): 327-339.
PMID
21723170
Source
pubmed
Published In
Molecular Cell
Volume
43
Issue
3
Publish Date
2011
Start Page
327
End Page
339
DOI
10.1016/j.molcel.2011.06.007

ATM regulates a DNA damage response posttranscriptional RNA operon in lymphocytes

Maintenance of genomic stability depends on the DNA damage response, a biologic barrier in early stages of cancer development. Failure of this response results in genomic instability and high predisposition toward lymphoma, as seen in patients with ataxia-telangiectasia mutated (ATM) dysfunction. ATM activates multiple cell-cycle checkpoints and DNA repair after DNA damage, but its influence on posttranscriptional gene expression has not been examined on a global level. We show that ionizing radiation modulates the dynamic association of the RNA-binding protein HuR with target mRNAs in an ATM-dependent manner, potentially coordinating the genotoxic response as an RNA operon. Pharmacologic ATM inhibition and use of ATM-null cells revealed a critical role for ATM in this process. Numerous mRNAs encoding cancer-related proteins were differentially associated with HuR depending on the functional state of ATM, in turn affecting expression of encoded proteins. The findings presented here reveal a previously unidentified role of ATM in controlling gene expression posttranscriptionally. Dysregulation of this DNA damage response RNA operon is probably relevant to lymphoma development in ataxiatelangiectasia persons. These novel RNA regulatory modules and genetic networks provide critical insight into the function of ATM in oncogenesis.

Authors
Mazan-Mamczarz, K; Hagner, PR; Zhang, Y; Dai, B; Lehrmann, E; Becker, KG; Keene, JD; Gorospe, M; Liu, Z; Gartenhaus, RB
MLA Citation
Mazan-Mamczarz, K, Hagner, PR, Zhang, Y, Dai, B, Lehrmann, E, Becker, KG, Keene, JD, Gorospe, M, Liu, Z, and Gartenhaus, RB. "ATM regulates a DNA damage response posttranscriptional RNA operon in lymphocytes." Blood 117.8 (2011): 2441-2450.
PMID
21209379
Source
scival
Published In
Blood
Volume
117
Issue
8
Publish Date
2011
Start Page
2441
End Page
2450
DOI
10.1182/blood-2010-09-310987

Tissue type-specific expression of the dsRNA-binding protein 76 and genome-wide elucidation of its target mRNAs.

BACKGROUND: RNA-binding proteins accompany all steps in the life of mRNAs and provide dynamic gene regulatory functions for rapid adjustment to changing extra- or intracellular conditions. The association of RNA-binding proteins with their targets is regulated through changing subcellular distribution, post-translational modification or association with other proteins. METHODOLOGY: We demonstrate that the dsRNA binding protein 76 (DRBP76), synonymous with nuclear factor 90, displays inherently distinct tissue type-specific subcellular distribution in the normal human central nervous system and in malignant brain tumors of glial origin. Altered subcellular localization and isoform distribution in malignant glioma indicate that tumor-specific changes in DRBP76-related gene products and their regulatory functions may contribute to the formation and/or maintenance of these tumors. To identify endogenous mRNA targets of DRBP76, we performed RNA-immunoprecipitation and genome-wide microarray analyses in HEK293 cells, and identified specific classes of transcripts encoding critical functions in cellular metabolism. SIGNIFICANCE: Our data suggest that physiologic DRBP76 expression, isoform distribution and subcellular localization are profoundly altered upon malignant transformation. Thus, the functional role of DRBP76 in co- or post-transcriptional gene regulation may contribute to the neoplastic phenotype.

Authors
Neplioueva, V; Dobrikova, EY; Mukherjee, N; Keene, JD; Gromeier, M
MLA Citation
Neplioueva, V, Dobrikova, EY, Mukherjee, N, Keene, JD, and Gromeier, M. "Tissue type-specific expression of the dsRNA-binding protein 76 and genome-wide elucidation of its target mRNAs. (Published online)" PLoS One 5.7 (July 23, 2010): e11710-.
Website
http://hdl.handle.net/10161/4556
PMID
20668518
Source
pubmed
Published In
PloS one
Volume
5
Issue
7
Publish Date
2010
Start Page
e11710
DOI
10.1371/journal.pone.0011710

The global dynamics of RNA stability orchestrates responses to cellular activation.

Transcriptomics is used to quantify changes in accumulated levels of mRNAs following cellular activation. These changes arise from the opposing fluxes of transcription and mRNA decay, both of which affect the functional dynamics of global gene expression. A study published recently in BMC Genomics focuses on the contribution made by mRNA stability in shaping the kinetics of gene responses in mammalian cells.

Authors
Keene, JD
MLA Citation
Keene, JD. "The global dynamics of RNA stability orchestrates responses to cellular activation. (Published online)" BMC Biol 8 (July 8, 2010): 95-.
PMID
20619007
Source
pubmed
Published In
BMC Biology
Volume
8
Publish Date
2010
Start Page
95
DOI
10.1186/1741-7007-8-95

Minireview: global regulation and dynamics of ribonucleic Acid.

Gene expression starts with transcription and is followed by multiple posttranscriptional processes that carry out the splicing, capping, polyadenylation, and export of each mRNA. Interest in posttranscriptional regulation has increased recently with explosive discoveries of large numbers of noncoding RNAs such as microRNAs, yet posttranscriptional processes depend largely on the functions of RNA-binding proteins as well. Glucocorticoid nuclear receptors are classical examples of environmentally reactive activators and repressors of transcription, but there has also been a significant increase in studies of the role of posttranscriptional regulation in endocrine responses, including insulin and insulin receptors, and parathyroid hormone as well as other hormonal responses, at the levels of RNA stability and translation. On the global level, the transcriptome is defined as the total RNA complement of the genome, and thereby, represents the accumulated levels of all expressed RNAs, because they are each being produced and eventually degraded in either the nucleus or the cytoplasm. In addition to RNA turnover, the many underlying posttranscriptional layers noted above that follow from the transcriptome function within a dynamic ribonucleoprotein (RNP) environment of global RNA-protein and RNA-RNA interactions. With the exception of the spliceosome and the ribosome, thousands of heterodispersed RNP complexes wherein RNAs are dynamically processed, trafficked, and exchanged are heterogeneous in size and composition, thus providing significant challenges to their investigation. Among the diverse RNPs that show dynamic features in the cytoplasm are processing bodies and stress granules as well as a large number of smaller heterogeneous RNPs distributed throughout the cell. Although the localization of functionally related RNAs within these RNPs are responsive to developmental and environmental signals, recent studies have begun to elucidate the global RNA components of RNPs that are dynamically coordinated in response to these signals. Among the factors that have been found to affect coordinated RNA regulation are developmental signals and treatments with small molecule drugs, hormones, and toxins, but this field is just beginning to understand the role of RNA dynamics in these responses.

Authors
Keene, JD
MLA Citation
Keene, JD. "Minireview: global regulation and dynamics of ribonucleic Acid." Endocrinology 151.4 (April 2010): 1391-1397. (Review)
PMID
20332203
Source
pubmed
Published In
Endocrinology
Volume
151
Issue
4
Publish Date
2010
Start Page
1391
End Page
1397
DOI
10.1210/en.2009-1250

Systematic analysis of posttranscriptional gene expression.

Recent systems studies of gene expression have begun to dissect the layers of regulation that underlie the eukaryotic transcriptome, the combined consequence of transcriptional and posttranscriptional events. Among the regulatory layers of the transcriptome are those of the ribonome, a highly dynamic environment of ribonucleoproteins in which RNA-binding proteins (RBPs), noncoding regulatory RNAs (ncRNAs) and messenger RNAs (mRNAs) interact. While multiple mRNAs are coordinated together in groups within the ribonome of a eukaryotic cell, each individual type of mRNA consists of multiple copies, each of which has an opportunity to be a member of more than one modular group termed a posttranscriptional RNA operon or regulon (PTRO). The mRNAs associated with each PTRO encode functionally related proteins and are coordinated at the levels of RNA stability and translation by the actions of the specific RBPs and noncoding regulatory RNAs. This article examines the methods that led to the elucidation of PTROs and the coordinating mechanisms that appear to regulate the RNA components of PTROs. Moreover, the article considers the characteristics of the dynamic systems that drive PTROs and how mRNA components are bound collectively in physical 'states' to respond to cellular perturbations and diseases. In conclusion, these studies have challenged the extent to which cellular mRNA abundance can inform investigators of the functional status of a biological system. We argue that understanding the ribonome has greater potential for illuminating the underlying coordination principles of growth, differentiation, and disease.

Authors
Morris, AR; Mukherjee, N; Keene, JD
MLA Citation
Morris, AR, Mukherjee, N, and Keene, JD. "Systematic analysis of posttranscriptional gene expression." Wiley Interdiscip Rev Syst Biol Med 2.2 (March 2010): 162-180. (Review)
PMID
20836020
Source
pubmed
Published In
Wiley Interdisciplinary Reviews: Systems Biology and Medicine
Volume
2
Issue
2
Publish Date
2010
Start Page
162
End Page
180
DOI
10.1002/wsbm.54

Proteomic and immunologic analyses of brain tumor exosomes.

Brain tumors are horrific diseases with almost universally fatal outcomes; new therapeutics are desperately needed and will come from improved understandings of glioma biology. Exosomes are endosomally derived 30-100 nm membranous vesicles released from many cell types into the extracellular milieu; surprisingly, exosomes are virtually unstudied in neuro-oncology. These microvesicles were used as vaccines in other tumor settings, but their immunological significance is unevaluated in brain tumors. Our purpose here is to report the initial biochemical, proteomic, and immunological studies on murine brain tumor exosomes, following known procedures to isolate exosomes. Our findings show that these vesicles have biophysical characteristics and proteomic profiles similar to exosomes from other cell types but that brain tumor exosomes have unique features (e.g., very basic isoelectric points, expressing the mutated tumor antigen EGFRvIII and the putatively immunosuppressive cytokine TGF-beta). Administration of such exosomes into syngeneic animals produced both humoral and cellular immune responses in immunized hosts capable of rejecting subsequent tumor challenges but failed to prolong survival in established orthotopic models. Control animals received saline or cell lysate vaccines and showed no antitumor responses. Exosomes and microvesicles isolated from sera of patients with brain tumors also possess EGFR, EGFRvIII, and TGF-beta. We conclude that exosomes released from brain tumor cells are biochemically/biophysically like other exosomes and have immune-modulating properties. They can escape the blood-brain barrier, with potential systemic and distal signaling and immune consequences.

Authors
Graner, MW; Alzate, O; Dechkovskaia, AM; Keene, JD; Sampson, JH; Mitchell, DA; Bigner, DD
MLA Citation
Graner, MW, Alzate, O, Dechkovskaia, AM, Keene, JD, Sampson, JH, Mitchell, DA, and Bigner, DD. "Proteomic and immunologic analyses of brain tumor exosomes." FASEB J 23.5 (May 2009): 1541-1557.
PMID
19109410
Source
pubmed
Published In
The FASEB journal : official publication of the Federation of American Societies for Experimental Biology
Volume
23
Issue
5
Publish Date
2009
Start Page
1541
End Page
1557
DOI
10.1096/fj.08-122184

The ribonome: a dominant force in co-ordinating gene expression.

The ribonome is the total cellular complement of RNAs and their regulatory factors functioning dynamically in time and space within ribonucleoprotein complexes. We theorize that the ribonome is an ancient central co-ordinator that has evolved to communicate on multiple levels to the proteome on the one hand (feed-forward), and the transcriptome and RNA processing machinery on the other (feed-back). Furthermore, the ribonome can potentially communicate to other cells horizontally with implications for biological information transfer and for the evolution of both RNA and DNA operating systems. The post-transcriptional RNA operon theory of co-regulated gene expression accounts for the co-ordinated dynamics of RNA-binding proteins within the cellular ribonome, thus allowing for the recombination and remodelling of the RNPs (ribonucleoproteins) to generate new combinations of functionally related proteins. Thus, post-transcriptional RNA operons form the core of the ribonomic operating system in which both their control and co-ordination govern outcomes. Within the ribonome, RNA-binding proteins control one another's mRNAs to keep the global mRNA environment in balance. We argue that these post-transcriptional ribonomic systems provide an information management and distribution centre for evolutionary expansion of multicellularity in tissues, organs, organisms, and their communities.

Authors
Mansfield, KD; Keene, JD
MLA Citation
Mansfield, KD, and Keene, JD. "The ribonome: a dominant force in co-ordinating gene expression." Biol Cell 101.3 (March 2009): 169-181. (Review)
PMID
19152504
Source
pubmed
Published In
Biology of the Cell
Volume
101
Issue
3
Publish Date
2009
Start Page
169
End Page
181
DOI
10.1042/BC20080055

Control of thymic T cell maturation, deletion and egress by the RNA-binding protein HuR

HuR emerged as a posttranscriptional regulator of mRNAs involved in cellular control, stress, and immunity but its role in governing such responses remains elusive. In this study, we assessed HuR's role in the staged progression of thymic T cell differentiation by means of its genetic ablation. Mice with an early deletion of HuR in thymocytes possess enlarged thymi but display a substantial loss of peripheral T cells. We show that this discordant phenotype related to specific defects in thymic cellular processes, which demonstrated HuR's involvement in: 1) intrinsic checkpoint signals suppressing the cell cycle of immature thymocyte progenitors, 2) TCR and antigenic signals promoting the activation and positive selection of mature thymocytes, 3) antigenic and death-receptor signals promoting thymocyte deletion, and 4) chemokine signals driving the egress of postselection thymocytes to the periphery. The cellular consequences of HuR's dysfunction were underlined by the aberrant expression of selective cell cycle regulators, TCR, and death-receptor signaling components. Our studies reveal the signal-dependent context of HuR's cellular activities in thymocytes and its importance in the generation of a physiological T cell pool. Copyright © 2009 by The American Association of Immunologists, Inc.

Authors
Papadaki, O; Milatos, S; Grammenoudi, S; Mukherjee, N; Keene, JD; Kontoyiannis, DL
MLA Citation
Papadaki, O, Milatos, S, Grammenoudi, S, Mukherjee, N, Keene, JD, and Kontoyiannis, DL. "Control of thymic T cell maturation, deletion and egress by the RNA-binding protein HuR." Journal of Immunology 182.11 (2009): 6779-6788.
PMID
19454673
Source
scival
Published In
Journal of immunology (Baltimore, Md. : 1950)
Volume
182
Issue
11
Publish Date
2009
Start Page
6779
End Page
6788
DOI
10.4049/jimmunol.0900377

Coordinated posttranscriptional mRNA population dynamics during T-cell activation.

Although RNA-binding proteins (RBPs) coordinate many key decisions during cell growth and differentiation, the dynamics of RNA-RBP interactions have not been extensively studied on a global basis. We immunoprecipitated endogenous ribonucleoprotein complexes containing HuR and PABP throughout a T-cell activation time course and identified the associated mRNA populations using microarrays. We used Gaussian mixture modeling as a discriminative model, treating RBP association as a discrete variable (target or not target), and as a generative model, treating RBP-association as a continuous variable (probability of association). We report that HuR interacts with different populations of mRNAs during T-cell activation. These populations encode functionally related proteins that are members of the Wnt pathway and proteins mediating T-cell receptor signaling pathways. Moreover, the mRNA targets of HuR were found to overlap with the targets of other posttranscriptional regulatory factors, indicating combinatorial interdependence of posttranscriptional regulatory networks and modules after activation. Applying HuR mRNA dynamics as a quantitative phenotype in the drug-gene-phenotype Connectivity Map, we identified candidate small molecule effectors of HuR and T-cell activation. We show that one of these candidates, resveratrol, exerts T-cell activation-dependent posttranscriptional effects that are rescued by HuR. Thus, we describe a strategy to systematically link an RBP and condition-specific posttranscriptional effects to small molecule drugs.

Authors
Mukherjee, N; Lager, PJ; Friedersdorf, MB; Thompson, MA; Keene, JD
MLA Citation
Mukherjee, N, Lager, PJ, Friedersdorf, MB, Thompson, MA, and Keene, JD. "Coordinated posttranscriptional mRNA population dynamics during T-cell activation." Mol Syst Biol 5 (2009): 288-.
PMID
19638969
Source
pubmed
Published In
Molecular systems biology
Volume
5
Publish Date
2009
Start Page
288
DOI
10.1038/msb.2009.44

Activity-dependent expression of ELAV/Hu RBPs and neuronal mRNAs in seizure and cocaine brain.

Growing evidence indicates that both seizure (glutamate) and cocaine (dopamine) treatment modulate synaptic plasticity within the mesolimbic region of the CNS. Activation of glutamatergic neurons depends on the localized translation of neuronal mRNA products involved in modulating synaptic plasticity. In this study, we demonstrate the dendritic localization of HuR and HuD RNA-binding proteins (RBPs) and their association with neuronal mRNAs following these two paradigms of seizure and cocaine treatment. Both the ubiquitously expressed HuR and neuronal HuD RBPs were detected in different regions as well as within dendrites of the brain and in dissociated neurons. Quantitative analysis revealed an increase in HuR, HuD and p-glycogen synthase kinase 3beta (GSK3beta) protein levels as well as neuronal mRNAs encoding Homer, CaMKIIalpha, vascular early response gene, GAP-43, neuritin, and neuroligin protein products following either seizure or cocaine treatment. Inhibition of the Akt/GSK3beta signaling pathway by acute or chronic LiCl treatment revealed changes in HuR, HuD, pGSK3beta, p-Akt, and beta-catenin protein levels. In addition, a genetically engineered hyperdopaminergic mouse model (dopamine transporter knockout) revealed decreased expression of HuR protein levels, but no significant change was observed in HuD or fragile-X mental retardation protein RBPs. Finally, our data suggest that HuR and HuD RBPs potentially interact directly with neuronal mRNAs important for differentiation and synaptic plasticity.

Authors
Tiruchinapalli, DM; Caron, MG; Keene, JD
MLA Citation
Tiruchinapalli, DM, Caron, MG, and Keene, JD. "Activity-dependent expression of ELAV/Hu RBPs and neuronal mRNAs in seizure and cocaine brain." J Neurochem 107.6 (December 2008): 1529-1543.
PMID
19014379
Source
pubmed
Published In
Journal of Neurochemistry
Volume
107
Issue
6
Publish Date
2008
Start Page
1529
End Page
1543
DOI
10.1111/j.1471-4159.2008.05718.x

Activity-dependent expression of RNA binding protein HuD and its association with mRNAs in neurons.

The dendritic trafficking of RNA binding proteins (RBPs) is an important posttranscriptional process involved in the regulation of synaptic plasticity. For example, HuD RBP binds to AU-rich elements (AREs) in the 3' untranslated regions (3'UTR) of immediate-early gene (IEG) transcripts, whose protein products directly affect synaptic plasticity. However, the subcellular localization of HuD RBPs and associated mRNAs has not been investigated following neuronal stimulation. Immunofluorescence analysis revealed activity-dependent dendritic localization of HuD RBPs following KCl stimulation in hippocampal neurons, while immunoprecipitation demonstrated the association of HuD RBP with neuronal mRNAs encoding neuritin, Homer1a, GAP-43, Neuroligins, Verge and CAMKIIalpha. Activity-dependent expression of HuD involves activation of NMDAR as NMDA receptor 1 knockout mice (Nr1(neo-/-)) exhibited decreased expression of HuD. Moreover, translational regulation of HuD-associated transcripts was suggested by its co-localization with poly-A-binding protein (PABP) as well as the cap-binding protein (eIF4E). We propose that post-transcriptional regulation of neuronal mRNAs by HuD RBPs mediates protein synthesis-dependent changes in synaptic plasticity.

Authors
Tiruchinapalli, DM; Ehlers, MD; Keene, JD
MLA Citation
Tiruchinapalli, DM, Ehlers, MD, and Keene, JD. "Activity-dependent expression of RNA binding protein HuD and its association with mRNAs in neurons." RNA Biol 5.3 (July 2008): 157-168.
PMID
18769135
Source
pubmed
Published In
RNA biology
Volume
5
Issue
3
Publish Date
2008
Start Page
157
End Page
168

Ribonomic analysis of human Pum1 reveals cis-trans conservation across species despite evolution of diverse mRNA target sets.

PUF family proteins are among the best-characterized regulatory RNA-binding proteins in nonmammalian species, but relatively little is known about mRNA targets or functions of mammalian PUF proteins. In this study, we used ribonomic analysis to identify and analyze mRNAs associated with ribonucleoproteins containing an endogenous human PUF protein, Pum1. Pum1-associated mRNAs were highly enriched for genes encoding proteins that function in transcriptional regulation and cell cycle/proliferation, results consistent with the posttranscriptional RNA regulon model and the proposed ancestral functions of PUF proteins in stem cell biology. Analysis of 3' untranslated region sequences of Pum1-associated mRNAs revealed a core Pum1 consensus sequence, UGUAHAUA. Pum1 knockdown demonstrated that Pum1 enhances decay of associated mRNAs, and relocalization of Pum1 to stress granules suggested that Pum1 functions in repression of translation. This study is the first in vivo genome-wide mRNA target identification of a mammalian PUF protein and provides direct evidence that human PUF proteins regulate stability of associated mRNAs. Comparison of Pum1-associated mRNAs to mRNA targets of PUF proteins from Saccharomyces cerevisiae and Drosophila melanogaster demonstrates how a well-conserved RNA-binding domain and cognate binding sequence have been evolutionarily rewired to regulate the collective expression of different sets of functionally related genes.

Authors
Morris, AR; Mukherjee, N; Keene, JD
MLA Citation
Morris, AR, Mukherjee, N, and Keene, JD. "Ribonomic analysis of human Pum1 reveals cis-trans conservation across species despite evolution of diverse mRNA target sets." Mol Cell Biol 28.12 (June 2008): 4093-4103.
PMID
18411299
Source
pubmed
Published In
Molecular and Cellular Biology
Volume
28
Issue
12
Publish Date
2008
Start Page
4093
End Page
4103
DOI
10.1128/MCB.00155-08

Signal sequence- and translation-independent mRNA localization to the endoplasmic reticulum.

The process of mRNA localization typically utilizes cis-targeting elements and trans-recognition factors to direct the compartmental organization of translationally suppressed mRNAs. mRNA localization to the endoplasmic reticulum (ER), in contrast, occurs via a co-translational, signal sequence/signal recognition particle (SRP)-dependent mechanism. We have utilized cell fractionation/cDNA microarray analysis, shRNA-mediated suppression of SRP expression, and mRNA reporter construct studies to define the role of the SRP pathway in ER-directed mRNA localization. Cell fractionation studies of mRNA partitioning between the cytosol and ER demonstrated the expected enrichment of cytosolic/nucleoplasmic protein-encoding mRNAs and secretory/integral membrane protein-encoding mRNAs in the cytosol and ER fractions, respectively, and identified a subpopulation of cytosolic/nucleoplasmic protein-encoding mRNAs in the membrane-bound mRNA pool. The latter finding suggests a signal sequence-independent pathway of ER-directed mRNA localization. Extending from these findings, mRNA partitioning was examined in stable SRP54 shRNA knockdown HeLa cell lines. shRNA-directed reductions in SRP did not globally alter mRNA partitioning patterns, although defects in membrane protein processing were observed, further suggesting the existence of multiple pathways for mRNA localization to the ER. ER localization of GRP94-encoding mRNA was observed when translation was disabled by mutation of the start codon/insertion of a 5'UTR stem-loop structure or upon deletion of the encoded signal sequence. Combined, these data indicate that the mRNA localization to the ER can be conferred independent of the signal sequence/SRP pathway and suggest that mRNA localization to the ER may utilize cis-encoded targeting information.

Authors
Pyhtila, B; Zheng, T; Lager, PJ; Keene, JD; Reedy, MC; Nicchitta, CV
MLA Citation
Pyhtila, B, Zheng, T, Lager, PJ, Keene, JD, Reedy, MC, and Nicchitta, CV. "Signal sequence- and translation-independent mRNA localization to the endoplasmic reticulum." RNA 14.3 (March 2008): 445-453.
PMID
18192611
Source
pubmed
Published In
RNA (New York, N.Y.)
Volume
14
Issue
3
Publish Date
2008
Start Page
445
End Page
453
DOI
10.1261/rna.721108

Post-transcriptional gene regulation by HuR promotes a more tumorigenic phenotype

In a breast tumor xenograft model, the MCT-1 oncogene increases the in vivo tumorgenicity of MCF7 cells by promoting angiogenesis and inhibiting apoptosis. Increases in the tumor microvascular density are accompanied by a strong reduction in the levels of the angiogenesis inhibitor thrombospondin-1 (TSP1), but the mechanisms underlying this process are unknown. We show that TSP1 expression is controlled, at least in part, by post-transcriptional events. Using RNA interference to knock down the expression of the RNA-binding protein HuR in MCF7 cells as well as HuR overexpression, we demonstrate that HuR plays an important role in translation of the TSP1 mRNA. Furthermore, employing the RIP-Chip assay yielded 595 transcripts with significantly altered binding to HuR in the more tumorigenic breast cancer clones compared with the weakly tumorigenic clones. These mRNAs clustered in several pathways implicated in the transformed phenotype, such as the RAS pathway (involved in mitogenesis), the PI3K pathway (evasion of apoptosis) and pathways mediating angiogenesis and the cellular response to hypoxia. These findings demonstrate for the first time that global changes in HuR-bound mRNAs are implicated in the evolution to a more tumorigenic phenotype in an in vivo tumor model and underscore the role of global mRNA-protein interactions toward tumor progression. © 2008 Macmillan Publishers Limited All rights reserved.

Authors
Mazan-Mamczarz, K; Hagner, PR; Corl, S; Srikantan, S; Wood, WH; Becker, KG; Gorospe, M; Keene, JD; Levenson, AS; Gartenhaus, RB
MLA Citation
Mazan-Mamczarz, K, Hagner, PR, Corl, S, Srikantan, S, Wood, WH, Becker, KG, Gorospe, M, Keene, JD, Levenson, AS, and Gartenhaus, RB. "Post-transcriptional gene regulation by HuR promotes a more tumorigenic phenotype." Oncogene 27.47 (2008): 6151-6163.
PMID
18641687
Source
scival
Published In
Oncogene: Including Oncogene Reviews
Volume
27
Issue
47
Publish Date
2008
Start Page
6151
End Page
6163
DOI
10.1038/onc.2008.215

Ribotrap: Targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs

Many elegant methodologies have been devised to explore RNA-protein as well as RNA-RNA interactions. Although the characterization of messages targeted by a specific RNA-binding protein (RBP) has been accelerated by the application of microarray technologies, reliable methods to describe the endogenous assembly of ribonucleoproteins (RNPs) are needed. However, this approach requires the targeted purification of a select mRNA under conditions favorable for the copurification of associated factors including RNA and protein components of the RNP. This chapter describes previous methods used to characterize RNPs in the context of in vitro approaches and presents the Ribotrap methodology, an in vivo protocol for message-specific purification of a target RNP. The method was developed in a yeast model system, yet is amenable to other in vivo cell systems including mammalian cell culture.© Humana Press, Totowa, NJ.

Authors
Beach, DL; Keene, JD
MLA Citation
Beach, DL, and Keene, JD. "Ribotrap: Targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs." Methods in Molecular Biology 419 (2008): 69-91.
PMID
18369976
Source
scival
Published In
Methods in molecular biology (Clifton, N.J.)
Volume
419
Publish Date
2008
Start Page
69
End Page
91
DOI
10.1007/978-1-59745-033-1_5

Caspase-mediated cleavage of HuR in the cytoplasm contributes to pp32/PHAP-I regulation of apoptosis

The RNA-binding protein HuR affects cell fate by regulating the stability and/or the translation of messenger RNAs that encode cell stress response proteins. In this study, we delineate a novel regulatory mechanism by which HuR contributes to stress-induced cell death. Upon lethal stress, HuR translocates into the cytoplasm by a mechanism involving its association with the apoptosome activator pp32/PHAP-I. Depleting the expression of pp32/PHAP-I by RNA interference reduces both HuR cytoplasmic accumulation and the efficiency of caspase activation. In the cytoplasm, HuR undergoes caspase-mediated cleavage at aspartate 226. This cleavage activity is significantly reduced in the absence of pp32/PHAP-I. Substituting aspartate 226 with an alanine creates a noncleavable isoform of HuR that, when over expressed, maintains its association with pp32/PHAP-I and delays the apoptotic response. Thus, we propose a model in which HuR association with pp32/PHAP-I and its caspase-mediated cleavage constitutes a regulatory step that contributes to an amplified apoptotic response. © The Rockefeller University Press.

Authors
Mazroui, R; Marco, SD; Clair, E; Roretz, CV; Tenenbaum, SA; Keene, JD; Saleh, M; Gallouzi, I-E
MLA Citation
Mazroui, R, Marco, SD, Clair, E, Roretz, CV, Tenenbaum, SA, Keene, JD, Saleh, M, and Gallouzi, I-E. "Caspase-mediated cleavage of HuR in the cytoplasm contributes to pp32/PHAP-I regulation of apoptosis." Journal of Cell Biology 180.1 (2008): 113-127.
PMID
18180367
Source
scival
Published In
The Journal of Cell Biology
Volume
180
Issue
1
Publish Date
2008
Start Page
113
End Page
127
DOI
10.1083/jcb.200709030

RNA regulons: coordination of post-transcriptional events.

Recent findings demonstrate that multiple mRNAs are co-regulated by one or more sequence-specific RNA-binding proteins that orchestrate their splicing, export, stability, localization and translation. These and other observations have given rise to a model in which mRNAs that encode functionally related proteins are coordinately regulated during cell growth and differentiation as post-transcriptional RNA operons or regulons, through a ribonucleoprotein-driven mechanism. Here I describe several recently discovered examples of RNA operons in budding yeast, fruitfly and mammalian cells, and their potential importance in processes such as immune response, oxidative metabolism, stress response, circadian rhythms and disease. I close by considering the evolutionary wiring and rewiring of these combinatorial post-transcriptional gene-expression networks.

Authors
Keene, JD
MLA Citation
Keene, JD. "RNA regulons: coordination of post-transcriptional events." Nat Rev Genet 8.7 (July 2007): 533-543. (Review)
PMID
17572691
Source
pubmed
Published In
Nature Reviews Genetics
Volume
8
Issue
7
Publish Date
2007
Start Page
533
End Page
543
DOI
10.1038/nrg2111

A two-phase innate host response to alphavirus infection identified by mRNP-tagging in vivo.

A concept fundamental to viral pathogenesis is that infection induces specific changes within the host cell, within specific tissues, or within the entire animal. These changes are reflected in a cascade of altered transcription patterns evident during infection. However, elucidation of this cascade in vivo has been limited by a general inability to distinguish changes occurring in the minority of infected cells from those in surrounding uninfected cells. To circumvent this inherent limitation of traditional gene expression profiling methods, an innovative mRNP-tagging technique was implemented to isolate host mRNA specifically from infected cells in vitro as well as in vivo following Venezuelan equine encephalitis virus (VEE) infection. This technique facilitated a direct characterization of the host defense response specifically within the first cells infected with VEE, while simultaneous total RNA analysis assessed the collective response of both the infected and uninfected cells. The result was a unique, multifaceted profile of the early response to VEE infection in primary dendritic cells, as well as in the draining lymph node, the initially targeted tissue in the mouse model. A dynamic environment of complex interactions was revealed, and suggested a two-step innate response in which activation of a subset of host genes in infected cells subsequently leads to activation of the surrounding uninfected cells. Our findings suggest that the application of viral mRNP-tagging systems, as introduced here, will facilitate a much more detailed understanding of the highly coordinated host response to infectious agents.

Authors
Konopka, JL; Penalva, LO; Thompson, JM; White, LJ; Beard, CW; Keene, JD; Johnston, RE
MLA Citation
Konopka, JL, Penalva, LO, Thompson, JM, White, LJ, Beard, CW, Keene, JD, and Johnston, RE. "A two-phase innate host response to alphavirus infection identified by mRNP-tagging in vivo." PLoS pathogens 3.12 (2007): e199-.
PMID
18215114
Source
scival
Published In
PLoS pathogens
Volume
3
Issue
12
Publish Date
2007
Start Page
e199
DOI
10.1371/journal.ppat.0030199

A two-phase innate host response to alphavirus infection identified by mRNP-tagging in vivo

A concept fundamental to viral pathogenesis is that infection induces specific changes within the host cell, within specific tissues, or within the entire animal. These changes are reflected in a cascade of altered transcription patterns evident during infection. However, elucidation of this cascade in vivo has been limited by a general inability to distinguish changes occurring in the minority of infected cells from those in surrounding uninfected cells. To circumvent this inherent limitation of traditional gene expression profiling methods, an innovative mRNP-tagging technique was implemented to isolate host mRNA specifically from infected cells in vitro as well as in vivo following Venezuelan equine encephalitis virus (VEE) infection. This technique facilitated a direct characterization of the host defense response specifically within the first cells infected with VEE, while simultaneous total RNA analysis assessed the collective response of both the infected and uninfected cells. The result was a unique, multifaceted profile of the early response to VEE infection in primary dendritic cells, as well as in the draining lymph node, the initially targeted tissue in the mouse model. A dynamic environment of complex interactions was revealed, and suggested a two-step innate response in which activation of a subset of host genes in infected cells subsequently leads to activation of the surrounding uninfected cells. Our findings suggest that the application of viral mRNP-tagging systems, as introduced here, will facilitate a much more detailed understanding of the highly coordinated host response to infectious agents. © 2007 Konopka et al.

Authors
Konopka, JL; Penalva, LO; Thompson, JM; White, LJ; Beard, CW; Keene, JD; Johnston, RE
MLA Citation
Konopka, JL, Penalva, LO, Thompson, JM, White, LJ, Beard, CW, Keene, JD, and Johnston, RE. "A two-phase innate host response to alphavirus infection identified by mRNP-tagging in vivo." PLoS Pathogens 3.12 (2007): 2038-2051.
Source
scival
Published In
PLoS pathogens
Volume
3
Issue
12
Publish Date
2007
Start Page
2038
End Page
2051
DOI
10.1371/journal.ppat.0030199

Biological clocks and the coordination theory of RNA operons and regulons.

One of the regulatory models of circadian rhythms involves the oscillation of transcription and translation. Although transcription factors have been widely examined during circadian processes, posttranscriptional mechanisms are less well-studied. Several laboratories have used microarrays to detect changes in mRNA expression throughout the circadian cycle and have found that mRNAs encoding the RNA-binding proteins (RBPs) nocturnin and butyrate response factor (BRF1) undergo rhythmic changes. Nocturnin is a deadenylation enzyme that removes poly(A) from the 3' ends of mRNAs, whereas BRF1 destabilizes mRNAs encoding early response gene (ERG) transcripts that contain AU-rich sequences in their 3'-untranslated regions (UTRs). Moroni and coworkers proposed that BRF1 functions as an oscillating posttranscriptional RNA operon (PTRO) that diurnally degrades ERG transcripts in peripheral organs (Keene and Tenenbaum 2002; Benjamin et al. 2006). The PTRO model posits that mRNAs can be members of one or more discrete functionally related subsets of mRNAs as determined by cis elements in mRNA and trans-acting RBPs or microRNAs that collectively recognize these cis elements (Keene 2007). This chapter describes the basis of posttranscriptional coordination by RNA operons and their potential for horizontal transfer among cells and discusses the potential for RBPs and microRNAs to participate in coordinating circadian rhythms and other biological clocks.

Authors
Keene, JD
MLA Citation
Keene, JD. "Biological clocks and the coordination theory of RNA operons and regulons." Cold Spring Harb Symp Quant Biol 72 (2007): 157-165. (Review)
PMID
18419273
Source
pubmed
Published In
Cold Spring Harbor Laboratory: Symposia on Quantitative Biology
Volume
72
Publish Date
2007
Start Page
157
End Page
165
DOI
10.1101/sqb.2007.72.013

Erratum: RIP-Chip: The isolation and identification of mRNAs, microRNAS and protein components of ribonucleoprotein complexes from cell extracts (Nature Protocols (2006) vol. 1 (302-307) 10.1038/nprot.2006.47)

Authors
Keene, JD; Komisarow, JM; Friedersdorf, MB
MLA Citation
Keene, JD, Komisarow, JM, and Friedersdorf, MB. "Erratum: RIP-Chip: The isolation and identification of mRNAs, microRNAS and protein components of ribonucleoprotein complexes from cell extracts (Nature Protocols (2006) vol. 1 (302-307) 10.1038/nprot.2006.47)." Nature Protocols 1.1 (2006).
Source
scival
Published In
Nature Protocols
Volume
1
Issue
1
Publish Date
2006

RIP-Chip: the isolation and identification of mRNAs, microRNAs and protein components of ribonucleoprotein complexes from cell extracts.

RNA targets of multitargeted RNA-binding proteins (RBPs) can be studied by various methods including mobility shift assays, iterative in vitro selection techniques and computational approaches. These techniques, however, cannot be used to identify the cellular context within which mRNAs associate, nor can they be used to elucidate the dynamic composition of RNAs in ribonucleoprotein (RNP) complexes in response to physiological stimuli. But by combining biochemical and genomics procedures to isolate and identify RNAs associated with RNA-binding proteins, information regarding RNA-protein and RNA-RNA interactions can be examined more directly within a cellular context. Several protocols--including the yeast three-hybrid system and immunoprecipitations that use physical or chemical cross-linking--have been developed to address this issue. Cross-linking procedures in general, however, are limited by inefficiency and sequence biases. The approach outlined here, termed RNP immunoprecipitation-microarray (RIP-Chip), allows the identification of discrete subsets of RNAs associated with multi-targeted RNA-binding proteins and provides information regarding changes in the intracellular composition of mRNPs in response to physical, chemical or developmental inducements of living systems. Thus, RIP-Chip can be used to identify subsets of RNAs that have related functions and are potentially co-regulated, as well as proteins that are associated with them in RNP complexes. Using RIP-Chip, the identification and/or quantification of RNAs in RNP complexes can be accomplished within a few hours or days depending on the RNA detection method used.

Authors
Keene, JD; Komisarow, JM; Friedersdorf, MB
MLA Citation
Keene, JD, Komisarow, JM, and Friedersdorf, MB. "RIP-Chip: the isolation and identification of mRNAs, microRNAs and protein components of ribonucleoprotein complexes from cell extracts." Nat Protoc 1.1 (2006): 302-307.
PMID
17406249
Source
pubmed
Published In
Nature Protocols
Volume
1
Issue
1
Publish Date
2006
Start Page
302
End Page
307
DOI
10.1038/nprot.2006.47

Stable ribosome binding to the endoplasmic reticulum enables compartment-specific regulation of mRNA translation.

In eukaryotic cells, protein synthesis is compartmentalized; mRNAs encoding secretory/membrane proteins are translated on endoplasmic reticulum (ER)-bound ribosomes, whereas mRNAs encoding cytosolic proteins are translated on free ribosomes. mRNA partitioning between the two compartments occurs via positive selection: free ribosomes engaged in the translation of signal sequence-encoding mRNAs are trafficked from the cytosol to the ER. After translation termination, ER-bound ribosomes are thought to dissociate, thereby completing a cycle of mRNA partitioning. At present, the physiological basis for termination-coupled ribosome release is unknown. To gain insight into this process, we examined ribosome and mRNA partitioning during the unfolded protein response, key elements of which include suppression of the initiation stage of protein synthesis and polyribosome breakdown. We report that unfolded protein response (UPR)-elicited polyribosome breakdown resulted in the continued association, rather than release, of ER-bound ribosomes. Under these conditions, mRNA translation in the cytosol was suppressed, whereas mRNA translation on the ER was sustained. Furthermore, mRNAs encoding key soluble stress proteins (XBP-1 and ATF-4) were translated primarily on ER-bound ribosomes. These studies demonstrate that ribosome release from the ER is termination independent and identify new and unexpected roles for the ER compartment in the translational response to induction of the unfolded protein response.

Authors
Stephens, SB; Dodd, RD; Brewer, JW; Lager, PJ; Keene, JD; Nicchitta, CV
MLA Citation
Stephens, SB, Dodd, RD, Brewer, JW, Lager, PJ, Keene, JD, and Nicchitta, CV. "Stable ribosome binding to the endoplasmic reticulum enables compartment-specific regulation of mRNA translation." Mol Biol Cell 16.12 (December 2005): 5819-5831.
PMID
16221886
Source
pubmed
Published In
Molecular Biology of the Cell
Volume
16
Issue
12
Publish Date
2005
Start Page
5819
End Page
5831
DOI
10.1091/mbc.E05-07-0685

Erratum: Posttranscriptional operons and regulons coordinating gene expression (Chromosome Research (2005) 13:3 (327-337))

Authors
Keene, JD; Lager, PJ
MLA Citation
Keene, JD, and Lager, PJ. "Erratum: Posttranscriptional operons and regulons coordinating gene expression (Chromosome Research (2005) 13:3 (327-337))." Chromosome Research 13.4 (2005): 424--.
Source
scival
Published In
Chromosome Research
Volume
13
Issue
4
Publish Date
2005
Start Page
424-

Post-transcriptional operons and regulons co-ordinating gene expression.

Experiments reported over the past several years, including genome-wide microarray approaches, have demonstrated that many eukaryotic RNA-binding proteins (RBPs) associate with multiple messenger RNAs (mRNAs) both in vitro and in vivo. This multi-targeted binding property of RBPs has led to a model of regulated gene expression in eukaryotes that we termed the post-transcriptional operon. This concept was established by an analogy between polycistronic mRNAs that are generated from bacterial operons, and the co-ordinated regulation of multiple monocistronic mRNAs by RBPs. Post-transcriptional operons represent a powerful mechanism to organize and express genetic information as functionally related combinations of monocistronic mRNAs. In fact, much of the diversification of individual proteomes may be determined by the combinatorial properties of post-transcriptional operons. This review examines data supporting the role of post-transcriptional operons and regulons in organizing genetic information and co-ordinating expression of functionally related transcripts from their origins at transcription to their subsequent splicing, export and translation.

Authors
Keene, JD; Lager, PJ
MLA Citation
Keene, JD, and Lager, PJ. "Post-transcriptional operons and regulons co-ordinating gene expression." Chromosome Res 13.3 (2005): 327-337. (Review)
PMID
15868425
Source
pubmed
Published In
Chromosome Research
Volume
13
Issue
3
Publish Date
2005
Start Page
327
End Page
337
DOI
10.1007/s10577-005-0848-1

Biotinylated tags for recovery and characterization of ribonucleoprotein complexes.

Determining the in vivo targets of RNA-binding proteins and characterizing the posttranscriptional networks in which they participate constitute major challenges in the post-genomic era. An important step in this direction is the development of methods that permit efficient recovery of ribonucleoprotein (RNP) complexes. We present an improved methodology for efficient isolation of mammalian cell RNPs in which a biotin acceptor peptide (BAP) is used to tag RNA-binding proteins. BAP-tagged RNA-binding proteins can be biotinylated in vivo by co-expression of the Escherichia coli BirA enzyme. RNP recovery was obtained using streptavidin sepharose beads, and messenger RNAs (mRNAs) were identified using multiprobe RNase protection assays and cDNA microarrays. Using this approach we efficiently recovered and quantified RNAs bound to cytoplasmic poly(A)-binding protein (PABP) and to nuclear human transformer 2 (hTra-2) with minimal background.

Authors
Penalva, LOF; Keene, JD
MLA Citation
Penalva, LOF, and Keene, JD. "Biotinylated tags for recovery and characterization of ribonucleoprotein complexes." Biotechniques 37.4 (October 2004): 604-610.
PMID
15517973
Source
pubmed
Published In
BioTechniques
Volume
37
Issue
4
Publish Date
2004
Start Page
604
End Page
610

RNA-binding proteins to assess gene expression states of co-cultivated cells in response to tumor cells.

BACKGROUND: Tumors and complex tissues consist of mixtures of communicating cells that differ significantly in their gene expression status. In order to understand how different cell types influence one another's gene expression, it will be necessary to monitor the mRNA profiles of each cell type independently and to dissect the mechanisms that regulate their gene expression outcomes. RESULTS: In order to approach these questions, we have used RNA-binding proteins such as ELAV/Hu, poly (A) binding protein (PABP) and cap-binding protein (eIF-4E) as reporters of gene expression. Here we demonstrate that the epitope-tagged RNA binding protein, PABP, expressed separately in tumor cells and endothelial cells can be used to discriminate their respective mRNA targets from mixtures of these cells without significant mRNA reassortment or exchange. Moreover, using this approach we identify a set of endothelial genes that respond to the presence of co-cultured breast tumor cells. CONCLUSION: RNA-binding proteins can be used as reporters to elucidate components of operational mRNA networks and operons involved in regulating cell-type specific gene expression in tissues and tumors.

Authors
Penalva, LOF; Burdick, MD; Lin, SM; Sutterluety, H; Keene, JD
MLA Citation
Penalva, LOF, Burdick, MD, Lin, SM, Sutterluety, H, and Keene, JD. "RNA-binding proteins to assess gene expression states of co-cultivated cells in response to tumor cells. (Published online)" Mol Cancer 3 (September 7, 2004): 24-.
PMID
15353001
Source
pubmed
Published In
Molecular Cancer
Volume
3
Publish Date
2004
Start Page
24
DOI
10.1186/1476-4598-3-24

Search for organising principles: understanding in systems biology.

Due in large measure to the explosive progress in molecular biology, biology has become arguably the most exciting scientific field. The first half of the 21st century is sometimes referred to as the 'era of biology', analogous to the first half of the 20th century, which was considered to be the 'era of physics'. Yet, biology is facing a crisis--or is it an opportunity--reminiscent of the state of biology in pre-double-helix time. The principal challenge facing systems biology is complexity. According to Hood, 'Systems biology defines and analyses the interrelationships of all of the elements in a functioning system in order to understand how the system works.' With 30000+ genes in the human genome the study of all relationships simultaneously becomes a formidably complex problem. Hanahan and Weinberg raised the question as to whether progress will consist of 'adding further layers of complexity to a scientific literature that is already complex almost beyond measure' or whether the progress will lead to a 'science with a conceptual structure and logical coherence that rivals that of chemistry or physics.' At the core of the challenge is the need for a new approach, a shift from reductionism to a holistic perspective. However, more than just a pronouncement of a new approach is needed. We suggest that what is needed is to provide a conceptual framework for systems biology research. We propose that the concept of a complex system, i.e. a system of systems as defined in mathematical general systems theory (MGST), is central to provide such a framework. We further argue that for a deeper understanding in systems biology investigations should go beyond building numerical mathematical or computer models--important as they are. Biological phenomena cannot be predicted with the level of numerical precision as in classical physics. Explanations in terms of how the categories of systems are organised to function in ever changing conditions are more revealing. Non-numerical mathematical tools are appropriate for the task. Such a categorical perspective led us to propose that the core of understanding in systems biology depends on the search for organising principles rather than solely on construction of predictive descriptions (i.e. models) that exactly outline the evolution of systems in space and time. The search for organising principles requires an identification/discovery of new concepts and hypotheses. Some of them, such as coordination motifs for transcriptional regulatory networks and bounded autonomy of levccels in a hierarchy, are outlined in this article. Experimental designs are outlined to help verify the applicability of the interaction balance principle of coordination to transcriptional and posttranscriptional networks.

Authors
Mesarovic, MD; Sreenath, SN; Keene, JD
MLA Citation
Mesarovic, MD, Sreenath, SN, and Keene, JD. "Search for organising principles: understanding in systems biology." Systems biology 1.1 (2004): 19-27.
PMID
17052112
Source
scival
Published In
IET Systems Biology
Volume
1
Issue
1
Publish Date
2004
Start Page
19
End Page
27
DOI
10.1049/sb:20045010

La gets its wings

Authors
Kenan, DJ; Keene, JD
MLA Citation
Kenan, DJ, and Keene, JD. "La gets its wings." Nature Structural and Molecular Biology 11.4 (2004): 303-305.
PMID
15048103
Source
scival
Published In
Nature Structural and Molecular Biology
Volume
11
Issue
4
Publish Date
2004
Start Page
303
End Page
305
DOI
10.1038/nsmb0404-303

Microbiology and Molecular Biology Reviews: Note from the editor in chief

Authors
Keene, JD
MLA Citation
Keene, JD. "Microbiology and Molecular Biology Reviews: Note from the editor in chief." Microbiology and Molecular Biology Reviews 68.2 (2004): i-.
Source
scival
Published In
Microbiology and Molecular Biology Reviews
Volume
68
Issue
2
Publish Date
2004
Start Page
i

Gene expression analysis of messenger RNP complexes.

RNA-binding proteins can organize messenger RNAs (mRNAs) into structurally and functionally related subsets, thus facilitating the coordinate production of gene classes necessary for complex cellular processes. Historically, in vitro methods primarily have been used to identify individual targets of mRNA-binding proteins. However, more direct methods are required for the identification of endogenously associated RNAs and their cognate proteins. To better understand posttranscriptional mRNA organization within the cell, we developed a systems biology approach to identify multiple-endogenous mRNA transcripts associated with RNA-binding proteins. This approach, termed ribonomics, takes advantage of high-throughput genomic array technologies that have greatly advanced the study of global gene expression changes. This chapter describes techniques for purifying mRNA-protein complexes (mRNPs) and identifying the associated mRNAs

Authors
Penalva, LOF; Tenenbaum, SA; Keene, JD
MLA Citation
Penalva, LOF, Tenenbaum, SA, and Keene, JD. "Gene expression analysis of messenger RNP complexes." Methods Mol Biol 257 (2004): 125-134.
PMID
14770002
Source
pubmed
Published In
Methods in molecular biology (Clifton, N.J.)
Volume
257
Publish Date
2004
Start Page
125
End Page
134
DOI
10.1385/1-59259-750-5:125

Preface

Authors
Hallett, M; II, LHP; Schomer, DL; Massey, JM
MLA Citation
Hallett, M, II, LHP, Schomer, DL, and Massey, JM. "Preface." Supplements to Clinical Neurophysiology 57.C (2004): v-.
Source
scival
Published In
Supplements to Clinical neurophysiology
Volume
57
Issue
C
Publish Date
2004
Start Page
v
DOI
10.1016/S1567-424X(09)70335-6

Posttranscriptional generation of macromolecular complexes.

Discrete classes of mRNAs that encode functionally related proteins are associated with sequence-specific RNA-binding proteins in yeast and mammalian cells. recently reported that pre-mRNAs encoding components of inhibitory synapses are bound to neuron-specific Nova RNA-binding proteins.

Authors
Keene, JD
MLA Citation
Keene, JD. "Posttranscriptional generation of macromolecular complexes." Mol Cell 12.6 (December 2003): 1347-1349.
PMID
14690589
Source
pubmed
Published In
Molecular Cell
Volume
12
Issue
6
Publish Date
2003
Start Page
1347
End Page
1349

Genome-wide regulatory analysis using en masse nuclear run-ons and ribonomic profiling with autoimmune sera.

Coordinated gene expression is influenced by transcriptional and posttranscriptional events and is necessary for efficient cell growth and differentiation. Genomic array technologies have afforded great advances in identifying global changes of gene expression in response to a variety of environmental stimuli. However, it has been a challenge to assess whether a concomitant effect on protein expression reflects the coordinated regulation of distinct subsets of mRNAs detected by cDNA arrays [Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 7018]. We have expanded the utility of cDNA arrays by using them to assist in elucidating combinatorial posttranscriptional eukaryotic operons [Mol. Cell 9 (2002) 1161]. In this study, we have used two mRNA partitioning methods in which: (1) subsets of mRNAs are isolated as endogenous mRNP complexes using autoimmune patient sera, and (2) transcriptional contributions to gene expression are assessed using cDNA array analysis of an en masse nuclear run-on assay (emRUN). The combination of these methods can provide an additional 'systems biology' discovery approach to gene expression analysis based upon the physical partitioning of mRNA subsets, as well as a functional partitioning of transcriptional and posttranscriptional processes. We demonstrate how these approaches can reduce transcriptomic complexity by partitioning mRNAs into biologically relevant subsets in order to derive information about the expression of multiple, but functionally linked, genes.

Authors
Tenenbaum, SA; Carson, CC; Atasoy, U; Keene, JD
MLA Citation
Tenenbaum, SA, Carson, CC, Atasoy, U, and Keene, JD. "Genome-wide regulatory analysis using en masse nuclear run-ons and ribonomic profiling with autoimmune sera." Gene 317.1-2 (October 23, 2003): 79-87.
PMID
14604794
Source
pubmed
Published In
Gene
Volume
317
Issue
1-2
Publish Date
2003
Start Page
79
End Page
87

Partitioning and translation of mRNAs encoding soluble proteins on membrane-bound ribosomes.

In eukaryotic cells, it is generally accepted that protein synthesis is compartmentalized; soluble proteins are synthesized on free ribosomes, whereas secretory and membrane proteins are synthesized on endoplasmic reticulum (ER)-bound ribosomes. The partitioning of mRNAs that accompanies such compartmentalization arises early in protein synthesis, when ribosomes engaged in the translation of mRNAs encoding signal-sequence-bearing proteins are targeted to the ER. In this report, we use multiple cell fractionation protocols, in combination with cDNA microarray, nuclease protection, and Northern blot analyses, to assess the distribution of mRNAs between free and ER-bound ribosomes. We find a broad representation of mRNAs encoding soluble proteins in the ER fraction, with a subset of such mRNAs displaying substantial ER partitioning. In addition, we present evidence that membrane-bound ribosomes engage in the translation of mRNAs encoding soluble proteins. Single-cell in situ hybridization analysis of the subcellular distribution of mRNAs encoding ER-localized and soluble proteins identify two overall patterns of mRNA distribution in the cell-endoplasmic reticular and cytosolic. However, both partitioning patterns include a distinct perinuclear component. These results identify previously unappreciated roles for membrane-bound ribosomes in the subcellular compartmentalization of protein synthesis and indicate possible functions for the perinuclear membrane domain in mRNA sorting in the cell.

Authors
Lerner, RS; Seiser, RM; Zheng, T; Lager, PJ; Reedy, MC; Keene, JD; Nicchitta, CV
MLA Citation
Lerner, RS, Seiser, RM, Zheng, T, Lager, PJ, Reedy, MC, Keene, JD, and Nicchitta, CV. "Partitioning and translation of mRNAs encoding soluble proteins on membrane-bound ribosomes." RNA 9.9 (September 2003): 1123-1137.
PMID
12923260
Source
pubmed
Published In
RNA (New York, N.Y.)
Volume
9
Issue
9
Publish Date
2003
Start Page
1123
End Page
1137

Differential phosphorylation and subcellular localization of La RNPs associated with precursor tRNAs and translation-related mRNAs

The La protein facilitates the production of tRNAs in the nucleus and the translation of specific mRNAs in the cytoplasm. We report that human La that is phosphorylated on serine 366 (pLa) is nucleoplasmic and associated with precursor tRNAs and other nascent RNA polymerase III transcripts while nonphosphorylated (np)La is cytoplasmic and associated with a subset of mRNAs that contain 5′-terminal oligopyrimidine (5′TOP) motifs known to control protein synthesis. Thus, La ribonucleoproteins (RNP) exist in distinct states that differ in subcellular localization, serine 366 phosphorylation, and associated RNAs. These results are consistent with a model in which the relative concentrations of the La S366 isoforms in different subcellular compartments in conjunction with the relative concentrations of specific RNA ligands in these compartments determine the differential association of npLa and pLa with their respective classes of associated RNAs.

Authors
Intine, RV; Tenenbaum, SA; Sakulich, AL; Keene, JD; Maraia, RJ
MLA Citation
Intine, RV, Tenenbaum, SA, Sakulich, AL, Keene, JD, and Maraia, RJ. "Differential phosphorylation and subcellular localization of La RNPs associated with precursor tRNAs and translation-related mRNAs." Molecular Cell 12.5 (2003): 1301-1307.
PMID
14636586
Source
scival
Published In
Molecular Cell
Volume
12
Issue
5
Publish Date
2003
Start Page
1301
End Page
1307
DOI
10.1016/S1097-2765(03)00429-5

Organizing mRNA export

A new study shows that cellular mRNAs can be organized and exported from the nucleus as functionally related groups by RNAbinding proteins, possibly corresponding to specific gene-expression networks activated by transcription factors. The combinatorial assortment of mRNAs as functional subsets has the potential to generate a variety of complex phenotypes from a modest number of genes.

Authors
Keene, JD
MLA Citation
Keene, JD. "Organizing mRNA export." Nature Genetics 33.2 (2003): 111-112.
PMID
12560814
Source
scival
Published In
Nature Genetics
Volume
33
Issue
2
Publish Date
2003
Start Page
111
End Page
112
DOI
10.1038/ng0203-111

RNA-binding protein HuR enhances p53 translation in response to ultraviolet light irradiation

Exposure to short-wavelength UV light (UVC) strongly induces p53 expression. In human RKO colorectal carcinoma cells, this increase was not due to elevated p53 mRNA abundance, cytoplasmic export of p53 mRNA, or UVC-triggered stabilization of the p53 protein. Instead, p53 translation was potently enhanced after UVC irradiation. The 3′ UTR of p53 was found to be a target of the RNA-binding protein HuR in a UVC-dependent manner in vitro and in vivo. HuR-overexpressing RKO cells displayed elevated p53 levels, whereas cells expressing reduced HuR showed markedly diminished p53 abundance and p53 translation. Our results demonstrate a role for HuR in binding to the p53 mRNA and enhancing its translation.

Authors
Mazan-Mamczarz, K; Galbán, S; Silanes, ILD; Martindale, JL; Atasoy, U; Keene, JD; Gorospe, M
MLA Citation
Mazan-Mamczarz, K, Galbán, S, Silanes, ILD, Martindale, JL, Atasoy, U, Keene, JD, and Gorospe, M. "RNA-binding protein HuR enhances p53 translation in response to ultraviolet light irradiation." Proceedings of the National Academy of Sciences of the United States of America 100.14 (2003): 8354-8359.
PMID
12821781
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
100
Issue
14
Publish Date
2003
Start Page
8354
End Page
8359
DOI
10.1073/pnas.1432104100

Eukaryotic mRNPs may represent posttranscriptional operons.

Genomic array analysis of endogenous mammalian ribonucleoproteins has recently revealed three novel findings: (1) mRNA binding proteins are associated with unique subpopulations of messages, (2) the compositions of these mRNA subsets can vary with growth conditions, and (3) the same mRNA species can be found in multiple mRNP complexes. Based on these and other findings, we propose a model of posttranscriptional gene expression in which mRNA binding proteins regulate mRNAs as subpopulations during cell growth and development. This model predicts that functionally related genes are regulated posttranscriptionally as groups by specific mRNA binding proteins that recognize sequence elements in common among the mRNAs.

Authors
Keene, JD; Tenenbaum, SA
MLA Citation
Keene, JD, and Tenenbaum, SA. "Eukaryotic mRNPs may represent posttranscriptional operons." Mol Cell 9.6 (June 2002): 1161-1167.
PMID
12086614
Source
pubmed
Published In
Molecular Cell
Volume
9
Issue
6
Publish Date
2002
Start Page
1161
End Page
1167

Autoimmune epitopes in messenger RNA.

Patients with systemic autoimmune disorders produce autoantibodies against sequence-specific conformational RNA epitopes on U1 snRNA, 28S rRNA, and transfer RNAs. The molecular basis for immunological reactivity with these highly abundant and stable RNAs is not understood. Here, we report the existence of discrete RNA epitopes in messenger RNAs that are generally less abundant and less stable than snRNAs and tRNAs. An iterative selection and amplification procedure using pooled autoimmune patient sera identified immunoreactive mRNA species. Following deconvolution of the pools to identify the reactive sera, several mRNAs recognized by these autoantibodies were cloned and sequenced. Detailed analysis using one particular serum indicated reactivity against the messages encoding alternative splicing factor (ASF/SF2) and calmodulin. Deletion and site-directed mutagenesis determined that an epitope recognized by this serum is located in a 17-base stem-loop structure common to both messages. This serum was then used to immunoprecipitate native mRNAs encoding ASF/SF2 and calmodulin from total HeLa cell RNA. Our results demonstrate that despite its low abundance and instability, messenger RNA is capable of reacting with autoantibodies generated during an autoimmune response. These data are consistent with direct presentation as a model to explain the generation of RNA conformation-specific autoantibodies.

Authors
Lipes, BD; Keene, JD
MLA Citation
Lipes, BD, and Keene, JD. "Autoimmune epitopes in messenger RNA." RNA 8.6 (June 2002): 762-771.
PMID
12088149
Source
pubmed
Published In
RNA (New York, N.Y.)
Volume
8
Issue
6
Publish Date
2002
Start Page
762
End Page
771

Ribonomics: identifying mRNA subsets in mRNP complexes using antibodies to RNA-binding proteins and genomic arrays.

Although in vitro methods have been used to identify putative targets of mRNA-binding proteins, direct in vivo methods are needed to identify endogenously associated mRNAs and their cognate proteins. Therefore, we have developed high-throughput methods to identify structurally and/or functionally related mRNA transcripts through their endogenous association with RNA-binding proteins. We have termed the identification and analysis of mRNA subsets using RNA-associated proteins ribonomics, and have established four primary steps for the method: (1) isolation of endogenous mRNA-protein complexes (mRNPs) under optimized conditions, (2) the en masse characterization of the protein and mRNA components associated with the targeted mRNP complexes, (3) identification of sequences or structural similarities among members of the mRNA subset, and (4) determination of functional relationships among the protein products coded for by members of the mRNA subset. We have hypothesized that mRNAs are organized into structurally and functionally linked groups to better affect information transfer through coordinate gene expression. The functional consequences of such organization would be to facilitate the production of proteins that regulate processes necessary for growth and differentiation. This article describes a series of biochemical techniques that deal with the first two steps of ribonomic profiling: purifying endogenous mRNP complexes and identifying multiple mRNA targets using microarray analysis.

Authors
Tenenbaum, SA; Lager, PJ; Carson, CC; Keene, JD
MLA Citation
Tenenbaum, SA, Lager, PJ, Carson, CC, and Keene, JD. "Ribonomics: identifying mRNA subsets in mRNP complexes using antibodies to RNA-binding proteins and genomic arrays." Methods 26.2 (February 2002): 191-198.
PMID
12054896
Source
pubmed
Published In
Methods
Volume
26
Issue
2
Publish Date
2002
Start Page
191
End Page
198
DOI
10.1016/S1046-2023(02)00022-1

A phosphorylated cytoplasmic autoantigen, GW182, associates with a unique population of human mRNAs within novel cytoplasmic speckles

A novel human cellular structure has been identified that contains a unique autoimmune antigen and multiple messenger RNAs. This complex was discovered using an autoimmune serum from a patient with motor and sensory neuropathy and contains a protein of 182 kDa. The gene and cDNA encoding the protein indicated an open reading frame with glycine-tryptophan (GW) repeats and a single RNA recognition motif. Both the patient's serum and a rabbit serum raised against the recombinant GW protein costained discrete cytoplasmic speckles designated as GW bodies (GWBs) that do not overlap with the Golgi complex, endosomes, lysosomes, or peroxisomes. The mRNAs associated with GW182 represent a clustered set of transcripts that are presumed to reside within the GW complexes. We propose that the GW ribonucleoprotein complex is involved in the posttranscriptional regulation of gene expression by sequestering a specific subset of gene transcripts involved in cell growth and homeostasis.

Authors
Eystathioy, T; Chan, EKL; Tenenbaum, SA; Keene, JD; Griffith, K; Fritzler, MJ
MLA Citation
Eystathioy, T, Chan, EKL, Tenenbaum, SA, Keene, JD, Griffith, K, and Fritzler, MJ. "A phosphorylated cytoplasmic autoantigen, GW182, associates with a unique population of human mRNAs within novel cytoplasmic speckles." Molecular Biology of the Cell 13.4 (2002): 1338-1351.
Source
scival
Published In
Molecular Biology of the Cell
Volume
13
Issue
4
Publish Date
2002
Start Page
1338
End Page
1351
DOI
10.1091/mbc.01-11-0544

Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome.

Following transcription and splicing, each mRNA of a mammalian cell passes into the cytoplasm where its fate is in the hands of a complex network of ribonucleoproteins (mRNPs). The success or failure of a gene to be expressed depends on the performance of this mRNP infrastructure. The entry, gating, processing, and transit of each mRNA through an mRNP network helps determine the composition of a cell's proteome. The machinery that regulates storage, turnover, and translational activation of mRNAs is not well understood, in part, because of the heterogeneous nature of mRNPs. Recently, subsets of cellular mRNAs clustered as members of mRNP complexes have been identified by using antibodies reactive with RNA-binding proteins, including ELAV/Hu, eIF-4E, and poly(A)-binding proteins. Cytoplasmic ELAV/Hu proteins are involved in the stability and translation of early response gene (ERG) transcripts and are expressed predominately in neurons. mRNAs recovered from ELAV/Hu mRNP complexes were found to have similar sequence elements, suggesting a common structural linkage among them. This approach opens the possibility of identifying transcripts physically clustered in vivo that may have similar fates or functions. Moreover, the proteins encoded by physically organized mRNAs may participate in the same biological process or structural outcome, not unlike operons and their polycistronic mRNAs do in prokaryotic organisms. Our goal is to understand the organization and flow of genetic information on an integrative systems level by analyzing the collective properties of proteins and mRNAs associated with mRNPs in vivo.

Authors
Keene, JD
MLA Citation
Keene, JD. "Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome." Proc Natl Acad Sci U S A 98.13 (June 19, 2001): 7018-7024. (Review)
PMID
11416181
Source
pubmed
Published In
Proceedings of the National Academy of Sciences of USA
Volume
98
Issue
13
Publish Date
2001
Start Page
7018
End Page
7024
DOI
10.1073/pnas.111145598

Microarray identification of FMRP-associated brain mRNAs and altered mRNA translational profiles in fragile X syndrome

Fragile X syndrome results from the absence of the RNA binding FMR protein. Here, mRNA was coimmunoprecipitated with the FMRP ribonucleoprotein complex and used to interrogate microarrays. We identified 432 associated mRNAs from mouse brain. Quantitative RT-PCR confirmed some to be >60-fold enriched in the immunoprecipitant. In parallel studies, mRNAs from polyribosomes of fragile X cells were used to probe microarrays. Despite equivalent cytoplasmic abundance, 251 mRNAs had an abnormal polyribosome profile in the absence of FMRP. Although this represents <2% of the total messages, 50% of the coimmunoprecipitated mRNAs with expressed human orthologs were found in this group. Nearly 70% of those transcripts found in both studies contain a G quartet structure, demonstrated as an in vitro FMRP target. We conclude that translational dysregulation of mRNAs normally associated with FMRP may be the proximal cause of fragile X syndrome, and we identify candidate genes relevant to this phenotype.

Authors
Brown, V; Jin, P; Ceman, S; Darnell, JC; O'Donnell, WT; Tenenbaum, SA; Jin, X; Feng, Y; Wilkinson, KD; Keene, JD; Darnell, RB; Warren, ST
MLA Citation
Brown, V, Jin, P, Ceman, S, Darnell, JC, O'Donnell, WT, Tenenbaum, SA, Jin, X, Feng, Y, Wilkinson, KD, Keene, JD, Darnell, RB, and Warren, ST. "Microarray identification of FMRP-associated brain mRNAs and altered mRNA translational profiles in fragile X syndrome." Cell 107.4 (2001): 477-487.
PMID
11719188
Source
scival
Published In
Cell
Volume
107
Issue
4
Publish Date
2001
Start Page
477
End Page
487
DOI
10.1016/S0092-8674(01)00568-2

Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays.

Genomic array technologies provide a means for profiling global changes in gene expression under a variety of conditions. However, it has been difficult to assess whether transcriptional or posttranscriptional regulation is responsible for these changes. Additionally, fluctuations in gene expression in a single cell type within a complex tissue like a tumor may be masked by overlapping profiles of all cell types in the population. In this paper, we describe the use of cDNA arrays to identify subsets of mRNAs contained in endogenous messenger ribonucleoprotein complexes (mRNPs) that are cell type specific. We identified mRNA subsets from P19 embryonal carcinoma stem cells by using mRNA-binding proteins HuB, eIF-4E, and PABP that are known to play a role in translation. The mRNA profiles associated with each of these mRNPs were unique and represented gene clusters that differed from total cellular RNA. Additionally, the composition of mRNAs detected in HuB-mRNP complexes changed dramatically after induction of neuronal differentiation with retinoic acid. We suggest that the association of structurally related mRNAs into mRNP complexes is dynamic and may help regulate posttranscriptional events such as mRNA turnover and translation. Recovering proteins specifically associated with mRNP complexes to identify and profile endogenously clustered mRNAs should provide insight into structural and functional relationships among gene transcripts and/or their protein products. We have termed this approach to functional genomics ribonomics and suggest that it will provide a useful paradigm for organizing genomic information in a biologically relevant manner.

Authors
Tenenbaum, SA; Carson, CC; Lager, PJ; Keene, JD
MLA Citation
Tenenbaum, SA, Carson, CC, Lager, PJ, and Keene, JD. "Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays." Proc Natl Acad Sci U S A 97.26 (December 19, 2000): 14085-14090.
PMID
11121017
Source
pubmed
Published In
Proceedings of the National Academy of Sciences of USA
Volume
97
Issue
26
Publish Date
2000
Start Page
14085
End Page
14090
DOI
10.1073/pnas.97.26.14085

Inhibition of polyglutamine protein aggregation and cell death by novel peptides identified by phage display screening.

Proteins with expanded polyglutamine domains cause eight inherited neurodegenerative diseases, including Huntington's, but the molecular mechanism(s) responsible for neuronal degeneration are not yet established. Expanded polyglutamine domain proteins possess properties that distinguish them from the same proteins with shorter glutamine repeats. Unlike proteins with short polyglutamine domains, proteins with expanded polyglutamine domains display unique protein interactions, form intracellular aggregates, and adopt a novel conformation that can be recognized by monoclonal antibodies. Any of these polyglutamine length-dependent properties could be responsible for the pathogenic effects of expanded polyglutamine proteins. To identify peptides that interfere with pathogenic polyglutamine interactions, we screened a combinatorial peptide library expressed on M13 phage pIII protein to identify peptides that preferentially bind pathologic-length polyglutamine domains. We identified six tryptophan-rich peptides that preferentially bind pathologic-length polyglutamine domain proteins. Polyglutamine-binding peptide 1 (QBP1) potently inhibits polyglutamine protein aggregation in an in vitro assay, while a scrambled sequence has no effect on aggregation. QBP1 and a tandem repeat of QBP1 also inhibit aggregation of polyglutamine-yellow fluorescent fusion protein in transfected COS-7 cells. Expression of QBP1 potently inhibits polyglutamine-induced cell death. Selective inhibition of pathologic interactions of expanded polyglutamine domains with themselves or other proteins may be a useful strategy for preventing disease onset or for slowing progression of the polyglutamine repeat diseases.

Authors
Nagai, Y; Tucker, T; Ren, H; Kenan, DJ; Henderson, BS; Keene, JD; Strittmatter, WJ; Burke, JR
MLA Citation
Nagai, Y, Tucker, T, Ren, H, Kenan, DJ, Henderson, BS, Keene, JD, Strittmatter, WJ, and Burke, JR. "Inhibition of polyglutamine protein aggregation and cell death by novel peptides identified by phage display screening." J Biol Chem 275.14 (April 7, 2000): 10437-10442.
PMID
10744733
Source
pubmed
Published In
The Journal of biological chemistry
Volume
275
Issue
14
Publish Date
2000
Start Page
10437
End Page
10442

Human La antigen is required for the hepatitis C virus internal ribosome entry site-mediated translation

The 5'-noncoding region (5'-NCR) of the hepatitis C virus (HCV) RNA genome serves as an internal ribosome entry site (IRES) and mediates translation initiation in a cap-independent manner. Previously, we reported the interaction between La antigen and the HCV IRES, which appeared to occur in the context of initiator AUG. It was further shown that HCV IRES-mediated translation was stimulated in the presence of human La antigen. In this study, we have defined the cis- and transacting elements responsible for La-5'-NCR interactions and established the dependence of the HCV IRES efficiency on cellular La antigen. During the La-IRES interaction, initiator AUG but not the neighboring codons was found to be the direct target of La binding. The C terminus effector domain-dependent modulation of La binding to the HCV IRES is demonstrated by deletion and substitution mutagenesis of the protein. An RNA systematic evolution of ligands by exponential enrichment (SELEX), generated against La protein that selectively binds La in HeLa lysates and competes for the protein binding to the 5'-NCR, was used to demonstrate the requirement of La for the HCV IRES function in the context of mono- and dicistronic mRNAs. Sequestration of La antigen by the RNA SELEX in HeLa translation lysates blocked the HCV and poliovirus IRES-mediated translation in vitro. The functional requirement of La protein for the HCV IRES activity was further established in a liver-derived cell line and in an add-back experiment in which the inhibited IRES was rescued by recombinant human La. These results strongly argue for the novel role of La protein during selection of the initiator AUG and its participation during internal initiation of translation of the HCV RNA genome.

Authors
Ali, N; Pruijn, GJM; Kenan, DJ; Keene, JD; Siddiqui, A
MLA Citation
Ali, N, Pruijn, GJM, Kenan, DJ, Keene, JD, and Siddiqui, A. "Human La antigen is required for the hepatitis C virus internal ribosome entry site-mediated translation." Journal of Biological Chemistry 275.36 (2000): 27531-27540.
PMID
10856291
Source
scival
Published In
The Journal of biological chemistry
Volume
275
Issue
36
Publish Date
2000
Start Page
27531
End Page
27540
DOI
10.1074/jbc.M001487200

ELAV tumor antigen, Hel-N1, increases translation of neurofilament M mRNA and induces formation of neurites in human teratocarcinoma cells.

Human ELAV proteins are implicated in cell growth and differentiation via regulation of mRNA expression in the cytoplasm. In human embryonic teratocarcinoma (hNT2) cells transfected with the human neuronal ELAV-like protein, Hel-N1, neurites formed, yet cells were not terminally differentiated. Cells in which neurite formation was associated with Hel-N1 overexpression, also expressed increased levels of endogenous neurofilament M (NF-M) protein, which distributed along the neurites. However, steady-state levels of NF-M mRNA remained similar whether or not hNT2 cells were transfected with Hel-N1. These findings suggest that turnover of NF-M mRNA was not affected by Hel-N1 expression, despite the fact that Hel-N1 can bind to the 3' UTR of NF-M mRNA and was found directly associated with NF-M mRNA in transfected cells. Analysis of the association of NF-M mRNA with the translational apparatus in Hel-N1 transfectants showed nearly complete recruitment to heavy polysomes, indicating that Hel-N1 caused an increase in translational initiation. Our results suggest that the stability and/or translation of ARE-containing mRNAs can be regulated independently by the ELAV protein, Hel-N1, depending upon sequence elements in the 3' UTRs and upon the inherent turnover rates of the mRNAs that are bound to Hel-N1 in vivo.

Authors
Antic, D; Lu, N; Keene, JD
MLA Citation
Antic, D, Lu, N, and Keene, JD. "ELAV tumor antigen, Hel-N1, increases translation of neurofilament M mRNA and induces formation of neurites in human teratocarcinoma cells." Genes Dev 13.4 (February 15, 1999): 449-461.
PMID
10049360
Source
pubmed
Published In
Genes & development
Volume
13
Issue
4
Publish Date
1999
Start Page
449
End Page
461

Why is Hu where? Shuttling of early-response-gene messenger RNA subsets.

Authors
Keene, JD
MLA Citation
Keene, JD. "Why is Hu where? Shuttling of early-response-gene messenger RNA subsets." Proc Natl Acad Sci U S A 96.1 (January 5, 1999): 5-7.
PMID
9874760
Source
pubmed
Published In
Proceedings of the National Academy of Sciences of USA
Volume
96
Issue
1
Publish Date
1999
Start Page
5
End Page
7

ELAV proteins stabilize deadenylated intermediates in a novel in vitro mRNA deadenylation/degradation system

We have developed an in vitro mRNA stability system using HeLa cell cytoplasmic S100 extracts and exogenous polyadenylated RNA substrates that reproduces regulated aspects of mRNA decay. The addition of cold poly(A) competitor RNA activated both a sequence-specific deadenylase activity in the extracts as well as a potent, ATP-dependent ribonucleolytic activity. The rates of both deadenylation and degradation were up-regulated by the presence of a variety of AU-rich elements in the body of substrate RNAs. Competition analyses demonstrated that trans-acting factors were required for RNA destabilization by AU-rich elements. The ~ 30-kD ELAV protein HuR specifically bound to RNAs containing an AU-rich element derived from the TNF-α mRNA in the in vitro system. Interaction of HuR with AU-rich elements, however, was not associated with RNA destabilization. Interestingly, recombinant ELAV proteins specifically stabilized deadenylated intermediates generated from the turnover of AU-rich element-containing substrate RNAs. These data suggest that mammalian ELAV proteins play a role in regulating mRNA stability by influencing the access of degradative enzymes to RNA substrates.

Authors
Ford, LP; Watson, J; Keene, JD; Wilusz, J
MLA Citation
Ford, LP, Watson, J, Keene, JD, and Wilusz, J. "ELAV proteins stabilize deadenylated intermediates in a novel in vitro mRNA deadenylation/degradation system." Genes and Development 13.2 (1999): 188-201.
PMID
9925643
Source
scival
Published In
Genes & development
Volume
13
Issue
2
Publish Date
1999
Start Page
188
End Page
201

In vitro selection of aptamers from RNA libraries.

Authors
Kenan, DJ; Keene, JD
MLA Citation
Kenan, DJ, and Keene, JD. "In vitro selection of aptamers from RNA libraries." Methods Mol Biol 118 (1999): 217-231.
PMID
10549525
Source
pubmed
Published In
Methods in molecular biology (Clifton, N.J.)
Volume
118
Publish Date
1999
Start Page
217
End Page
231
DOI
10.1385/1-59259-676-2:217

Identification of specific protein-RNA target sites using libraries of natural sequences.

Authors
Andrews, LG; Keene, JD
MLA Citation
Andrews, LG, and Keene, JD. "Identification of specific protein-RNA target sites using libraries of natural sequences." Methods in molecular biology (Clifton, N.J.) 118 (1999): 233-244.
PMID
10549526
Source
scival
Published In
Methods in molecular biology (Clifton, N.J.)
Volume
118
Publish Date
1999
Start Page
233
End Page
244

ELAV protein HuA (HuR) can redistribute between nucleus and cytoplasm and is upregulated during serum stimulation and T cell activation.

ELAV proteins are implicated in regulating the stability and translation of cytokine and growth regulatory mRNAs such as GM-CSF, IL-2, c-myc, c-fos and GLUT1 by binding to their AU-rich 3'UTRs. The tissue-specific ELAV protein HuB (aka. Hel-N1) is predominantly cytoplasmic and has been shown to stabilize GLUT1 and c-myc mRNAs and to increase their translation following ectopic expression in 3T3-L1 cells. We report that the most widely expressed mouse ELAV protein, mHuA, is predominately nuclear in cultured NIH-3T3 cells, but is localized in the cytoplasm during early G1 of the cell cycle. Therefore, much like the primarily cytoplasmic HuB, HuA becomes temporally localized in the cytoplasm where it can potentially regulate the stability or translation of bound mRNAs. Moreover, we report that stimulation of mouse spleen cells using either mitogenic or sub-mitogenic levels of anti-CD3/CD28 resulted in a dramatic increase in the level of HuA. Upregulation of HuA corresponds to previously documented increases in cytokine expression which are due to increased mRNA stability following T cell activation. Consistent with these findings, HuA was down regulated in quiescent cells and upregulated in 3T3 cells following serum stimulation. The increase of murine HuA during the cell cycle closely resembles that of cyclin B1 which peaks in G2/M. Together with our earlier studies, these data indicate that mammalian ELAV proteins function during cell growth and differentiation due in part to their effects on posttranscriptional stability and translation of multiple growth regulatory mRNAs. This supports the hypothesis that ELAV proteins can function as transacting factors which affect a default pathway of mRNA degradation involved in the expression of growth regulatory proteins.

Authors
Atasoy, U; Watson, J; Patel, D; Keene, JD
MLA Citation
Atasoy, U, Watson, J, Patel, D, and Keene, JD. "ELAV protein HuA (HuR) can redistribute between nucleus and cytoplasm and is upregulated during serum stimulation and T cell activation." J Cell Sci 111 ( Pt 21) (November 1998): 3145-3156.
PMID
9763509
Source
pubmed
Published In
Journal of cell science
Volume
111 ( Pt 21)
Publish Date
1998
Start Page
3145
End Page
3156

Messenger ribonucleoprotein complexes containing human ELAV proteins: interactions with cytoskeleton and translational apparatus.

Mammalian ELAV proteins bind to polyadenylated messenger RNAs and have specificity for AU-rich sequences. Preferred binding sites in vitro include the AUUUA pentamer and related sequences present in the 3' untranslated regions of many growth regulatory mRNAs. Human ELAV (hELAV) proteins have been implicated in post-transcriptional regulation of gene expression by their effects on the stability and translatability of growth regulatory mRNAs. We have examined the intracellular localization of ELAV proteins in neurons and in tumor cells of neuronal origin using indirect immunofluorescence, confocal microscopy and biochemical separation. Mammalian neuronal ELAV proteins are found predominantly in the cytoplasm of cells in mRNP complexes termed alpha complexes which, when associated with polysomes, form large and high density ss complexes, as assayed by glycerol and accudenz gradients, respectively. Puromycin, cytochalasin or EDTA treatments disrupt beta complexes causing the release of alpha complexes, which then appear, by confocal microscopy, as large hELAV mRNP granules associated with microtubules. Association of partially purified hELAV mRNP alpha complexes with microtubules was confirmed by in vitro reconstitution assays. Furthermore, colchicine treatment of cells suggested that association of hELAV mRNP alpha complexes with microtubules is also necessary for the formation of ss complexes. Our data suggest a model in which a subset of mRNAs is associated with microtubules as ELAV mRNP particles (alpha complexes) which, in turn, associate with polysomes to form a translational apparatus (beta complex) that is, through polysomes, associated with the microfilament cytoskeletal network. hELAV proteins in these mRNP granules may affect post-transcriptional regulation of gene expression via the intracellular transport, localization and/or translation of growth regulatory mRNAs.

Authors
Antic, D; Keene, JD
MLA Citation
Antic, D, and Keene, JD. "Messenger ribonucleoprotein complexes containing human ELAV proteins: interactions with cytoskeleton and translational apparatus." J Cell Sci 111 ( Pt 2) (January 1998): 183-197.
PMID
9405302
Source
pubmed
Published In
Journal of cell science
Volume
111 ( Pt 2)
Publish Date
1998
Start Page
183
End Page
197

Embryonic lethal abnormal visual RNA-binding proteins involved in growth, differentiation, and posttranscriptional gene expression.

Authors
Antic, D; Keene, JD
MLA Citation
Antic, D, and Keene, JD. "Embryonic lethal abnormal visual RNA-binding proteins involved in growth, differentiation, and posttranscriptional gene expression." Am J Hum Genet 61.2 (August 1997): 273-278. (Review)
PMID
9311730
Source
pubmed
Published In
The American Journal of Human Genetics
Volume
61
Issue
2
Publish Date
1997
Start Page
273
End Page
278
DOI
10.1086/514866

Ectopic expression of Hel-N1, an RNA-binding protein, increases glucose transporter (GLUT1) expression in 3T3-L1 adipocytes

3T3-L1 preadipocytes ectopically expressing the mammalian RNA-binding protein Hel-N1 expressed up to 10-fold more glucose transporter (GLUT1) protein and exhibited elevated rates of basal glucose uptake. Hel-N1 is a member of the ELAV-like family of proteins associated with the induction and maintenance of differentiation in various species. ELAV proteins are known to bind in vitro to short stretches of uridylates in the 3' untranslated regions (3'UTRs) of unstable mRNAs encoding growth-regulatory proteins involved in transcription and signal transduction. GLUT1 mRNA also contains a large 3'UTR with a U-rich region that binds specifically to Hel-N1 in vitro. Analysis of the altered GLUT1 expression at the translational and posttranscriptional levels suggested a mechanism involving both mRNA stabilization and accelerated formation of translation initiation complexes. These findings are consistent with the hypothesis that the Hel-N1 family of proteins modulate gene expression at the level of mRNA in the cytoplasm.

Authors
Jain, RG; Andrews, LG; McGowan, KM; Pekala, PH; Keene, JD
MLA Citation
Jain, RG, Andrews, LG, McGowan, KM, Pekala, PH, and Keene, JD. "Ectopic expression of Hel-N1, an RNA-binding protein, increases glucose transporter (GLUT1) expression in 3T3-L1 adipocytes." Molecular and Cellular Biology 17.2 (1997): 954-962.
PMID
9001249
Source
scival
Published In
Molecular and Cellular Biology
Volume
17
Issue
2
Publish Date
1997
Start Page
954
End Page
962

RNA surfaces as functional mimetics of proteins.

Accumulating evidence suggests that RNA molecules can form surfaces that mimic those of proteins. Reactivity of autoantibodies with RNA surfaces may be due to cross-reactivity between a protein epitope and the RNA. The structural mimicry detected by an autoantibody may reflect functional mimicry.

Authors
Keene, JD
MLA Citation
Keene, JD. "RNA surfaces as functional mimetics of proteins." Chem Biol 3.7 (July 1996): 505-513. (Review)
PMID
8807880
Source
pubmed
Published In
Chemistry & Biology
Volume
3
Issue
7
Publish Date
1996
Start Page
505
End Page
513

Hel-N1/Hel-N2 proteins are bound to poly(A)+ mRNA in granular RNP structures and are implicated in neuronal differentiation.

Human proteins Hel-N1 and Hel-N2 contain three RNA recognition motifs (RRMs), and are members of a family of proteins highly homologous to Drosophila ELAV, which is essential for neuronal differentiation. Both proteins bind to A+U-rich 3' untranslated regions of a variety of growth-related mRNAs in vitro. Here we demonstrate that in medulloblastoma cells derived from childhood brain tumors, Hel-N1 and Hel-N2 are mainly expressed in the cytoplasm, but are detectable in the nucleus. Both proteins are associated with polysomes and can be UV-crosslinked to poly(A)+ mRNA in cell extracts. In the cytoplasm the Hel-N1 protein family resides in granular structures that may contain multiple protein molecules bound to each mRNA. Evidence supporting this multimeric ribonucleoprotein (RNP) model includes in vitro reconstitution and competition experiments in which addition of a single RRM (RRM3) can alter complex formation. As in medulloblastoma cells, the Hel-N1 protein family is present in granular particles in the soma and the proximal regions of dendrites of cultured neurons, and colocalizes with ribosomes. In addition, we demonstrate that expression of the Hel-N1 protein family is up-regulated during neuronal differentiation of embryonic carcinoma P19 cells. Our data suggest that the Hel-N1 protein family is associated with the translational apparatus and implicated in both mRNA metabolism and neuronal differentiation. Furthermore, our findings open the possibility that these proteins participate in mRNA homeostasis in the dendrites and soma of mature neurons.

Authors
Gao, FB; Keene, JD
MLA Citation
Gao, FB, and Keene, JD. "Hel-N1/Hel-N2 proteins are bound to poly(A)+ mRNA in granular RNP structures and are implicated in neuronal differentiation." J Cell Sci 109 ( Pt 3) (March 1996): 579-589.
PMID
8907704
Source
pubmed
Published In
Journal of cell science
Volume
109 ( Pt 3)
Publish Date
1996
Start Page
579
End Page
589

Letters

Authors
Keene, JD
MLA Citation
Keene, JD. "Letters." Scientist 10.16 (1996).
Source
scival
Published In
Scientist (Philadelphia, Pa.)
Volume
10
Issue
16
Publish Date
1996

RNA recognition by autoantigens and autoantibodies.

The La, Ro, Sm and RNP autoantigens have been intensely studied over the past decade since cDNAs encoding autoantigens have been available. Most of these autoantigens are closely associated with RNA in RNP particles and molecular studies have provided insights into their modes of recognition and binding to RNA. For example, a common RNA Recognition Motif (RRM) was found to be a critical component of the RNA-binding domain of these autoantigens and the three dimensional structure of the RRM has been solved. As described in other articles in this series, the presence of La, Ro, Sm and RNP autoantibodies correlates with disease subsets, such as Sjogren's syndrome, systemic lupus erythematous and other connective tissue diseases. Immunological analysis of sera from autoimmune patients using recombinant autoantigens has revealed that multiple epitopes reside along the proteins and these represent both continuous and discontinuous (conformational) autotopes. Findings to date support a model of autoantibody induction which involves the direct presentation of proteinaceous autoantigens to the immune system. Circumstantial evidence has suggested that immunological crossreactivity between systemic autoantigens and structural components of infectious agents may play an initial role in the autoimmune response to certain antigens. However, the etiology of autoimmune diseases is probably multifactoral with genetic and other immune features acting on the organismal level. In addition, RNA molecules themselves can be autoantigens with higher order structural conformations which are recognized by RNP-type autoantibodies. Immune crossreactivity and/or direct presentation may generate autoantibodies reactive with conformational RNA epitopes. If crossreactivity with components of cellular or infectious agents give rise to RNA epitopes, they may represent structural or functional mimetics of the primary epitopes that actually drive the response. These ideas are discussed with respect to the role of mimetic processes in molecular recognition during autoimmunity.

Authors
Keene, JD
MLA Citation
Keene, JD. "RNA recognition by autoantigens and autoantibodies." Mol Biol Rep 23.3-4 (1996): 173-181. (Review)
PMID
9112226
Source
pubmed
Published In
Molecular Biology Reports
Volume
23
Issue
3-4
Publish Date
1996
Start Page
173
End Page
181

Sequences within a small yeast RNA required for inhibition of internal initiation of translation: Interaction with La and other cellular proteins influences its inhibitory activity

We recently reported purification, determination of the nucleotide sequence, and cloning of a 60-nucleotide RNA (I-RNA) from the yeast Saccharomyces cerevisiae which preferentially blocked cap-independent, internal ribosome entry site (IRES)-mediated translation programmed by the poliovirus (PV) 5' untranslated region (UTR). The I-RNA appeared to inhibit IRES-mediated translation by virtue of its ability to bind a 52-kDa polypeptide which interacts with the 5' UTR of viral RNA. We demonstrate here that the HeLa 52-kDa I-RNA-binding protein is immunologically identical to human La autoantigen. Moreover, I-RNA-mediated inhibition of PV 5' UTR- dependent translation in cell extracts can be reversed by exogenous addition of purified La protein. By using I-RNAs with defined deletions, we have identified sequences of I-RNA required for inhibition of internal initiation of translation. Two smaller fragments of I-RNA (16 and 25 nucleotides) inhibited PV UTR-mediated translation from both monocistronic and bicistronic RNAs. When transfected into HeLa cells, these derivatives of I-RNA inhibited translation of PV RNA. A comparison of protein binding by active and inactive I-RNA mutants demonstrates that in addition to the La protein, three other polypeptides with apparent molecular masses of 80, 70, and 37 kDa may influence the translation-inhibitory activity of I-RNA.

Authors
Das, S; Kenan, DJ; Bocskai, D; Keene, JD; Dasgupta, A
MLA Citation
Das, S, Kenan, DJ, Bocskai, D, Keene, JD, and Dasgupta, A. "Sequences within a small yeast RNA required for inhibition of internal initiation of translation: Interaction with La and other cellular proteins influences its inhibitory activity." Journal of Virology 70.3 (1996): 1624-1632.
PMID
8627683
Source
scival
Published In
Journal of virology
Volume
70
Issue
3
Publish Date
1996
Start Page
1624
End Page
1632

Randomization and selection of RNA to identify targets for RRM RNA-binding proteins and antibodies.

Authors
Keene, JD
MLA Citation
Keene, JD. "Randomization and selection of RNA to identify targets for RRM RNA-binding proteins and antibodies." Methods Enzymol 267 (1996): 367-383.
PMID
8743327
Source
pubmed
Published In
Methods in Enzymology
Volume
267
Publish Date
1996
Start Page
367
End Page
383

In vitro RNA selection identifies RNA ligands that specifically bind to eukaryotic translation initiation factor 4B: The role of the RNA recognition motif

Translation initiation factor eIF-4B is an RNA-binding protein that promotes the association of the mRNA to the 40S ribosomal subunit. One of its better characterized features is the ability to stimulate the activity of the DEAD box RNA helicase eIF-4A. In addition to an RNA recognition motif (RRM) located near its amino-terminus, eIF-4B contains an RNA-binding region in its carboxy-terminal half. The eIF-4A helicase stimulatory activity resides in the carboxy-terminal half of eIF-4B, and the RRM has little impact on this function. To better understand the role of the eIF-4B RRM, it was of interest to identify its specific RNA target sequence. To this end, in vitro RNA selection/amplifications were performed using various portions of eIF-4B. These experiments were designed to test the RNA recognition specificity of the two eIF-4B regions implicated in RNA binding and to assess the influence of eIF-4A on the RNA-binding specificity. The RRM was shown to bind with high affinity to an RNA stem-loop structure with conserved primary sequence elements. Discrete point mutations in an in vitro-selected RNA identified residues critical for RNA binding. Neither the carboxy-terminal RNA- interaction region, nor eIF-4A, influenced the structure of the high-affinity RNA ligands selected by eIF-4B, and eIF-4A by itself did not select any specific RNA target. Previous studies have demonstrated an interaction of eIF-4B with ribosomes, and it was suggested that this association is mediated through binding to ribosomal RNA. We show that the RRM of eIF-4B interacts directly with 18S rRNA and this interaction is inhibited by an excess of the eIF-4B in vitro-selected RNA. eIF-4B could bind simultaneously to two different RNA molecules, supporting a model whereby eIF-4B promotes ribosome binding to the 5' untranslated region of a mRNA by bridging it to 18S rRNA.

Authors
Méthot, N; Pickett, G; Keene, JD; Sonenberg, N
MLA Citation
Méthot, N, Pickett, G, Keene, JD, and Sonenberg, N. "In vitro RNA selection identifies RNA ligands that specifically bind to eukaryotic translation initiation factor 4B: The role of the RNA recognition motif." RNA 2.1 (1996): 38-50.
PMID
8846295
Source
scival
Published In
RNA (New York, N.Y.)
Volume
2
Issue
1
Publish Date
1996
Start Page
38
End Page
50

Overexpression of the arginine-rich carboxy-terminal region of U1 snRNP 70K inhibits both splicing and nucleocytoplasmic transport of mRNA.

Transient transfection of the U1 snRNP 70K protein into COS cells induced nuclear reorganization and redistribution of the splicing factor SC-35, whereas hnRNP proteins were not affected. Correspondingly, splicing and nucleocytoplasmic transport of a coexpressed mRNA substrate was reduced by overexpression of U1-70K. The carboxy-terminal portion of U1-70K-encompassing repeats of Arg/Ser, Arg/Glu, and Arg/Asp localizes to the nucleus independently of U1 RNA and was responsible for these inhibitory effects. This region of U1-70K contains amino acid residues similar to those found in splicing factors SC-35, U2AF, su(wa), and in other SR proteins suggesting that U1-70K protein may serve as a focus of assembly for functional components of the splicing/transport machinery. These findings are compatible with models that propose that direct interaction between U1-70K and SR proteins play a regulatory role in early events of spliceosome assembly.

Authors
Romac, JM; Keene, JD
MLA Citation
Romac, JM, and Keene, JD. "Overexpression of the arginine-rich carboxy-terminal region of U1 snRNP 70K inhibits both splicing and nucleocytoplasmic transport of mRNA." Genes Dev 9.11 (June 1, 1995): 1400-1410.
PMID
7797079
Source
pubmed
Published In
Genes & development
Volume
9
Issue
11
Publish Date
1995
Start Page
1400
End Page
1410

Hel-N1, an RNA-binding protein, is a ligand for an A + U rich region of the GLUT1 3' UTR.

Hel-N1, is an RRM protein which is a mammalian homologue of the Drosophila melanogaster RNA binding protein, ELAV (embryonic lethal abnormal vision). Hel-N1 binds to RNA containing short stretches of uridylates similar to those found in the 3' untranslated regions (3'-UTRs) of oncoprotein and cytokine mRNAs. The GLUT1 glucose transporter has an extensive 3' UTR that is AU-rich reminiscent of the 3'UTR of an oncogene mRNA. An in vitro RNA binding assay using Hel-N1 demonstrated binding to a specific portion of the GLUT1 3'UTR. Analysis of the folding pattern of this region depicted the retention of a stem loop structure, wherein the loop is composed of a stretch of uridylates. To further analyze the potential function of Hel-N1, stable transfectants were made in the 3T3-L1 cell line. The transfectants have been characterized, and the presence of the Hel-N1 DNA and protein verified. Data indicate Hel-N1 is a ligand for GLUT1 and its binding affects the stability and translatability of the GLUT1 message.

Authors
Jain, RG; Andrews, LG; McGowan, KM; Gao, F; Keene, JD; Pekala, PP
MLA Citation
Jain, RG, Andrews, LG, McGowan, KM, Gao, F, Keene, JD, and Pekala, PP. "Hel-N1, an RNA-binding protein, is a ligand for an A + U rich region of the GLUT1 3' UTR." Nucleic acids symposium series 33 (1995): 209-211.
PMID
8643372
Source
scival
Published In
Nucleic acids symposium series
Issue
33
Publish Date
1995
Start Page
209
End Page
211

Erratum: Direct interactions between autoantigen La and human immunodeficiency virus leader RNA (Journal of Virology 68:11 (7014))

Authors
Chang, Y-N; Kenan, DJ; Keene, JD; Gatignol, A; Jeang, K-T
MLA Citation
Chang, Y-N, Kenan, DJ, Keene, JD, Gatignol, A, and Jeang, K-T. "Erratum: Direct interactions between autoantigen La and human immunodeficiency virus leader RNA (Journal of Virology 68:11 (7014))." Journal of Virology 69.1 (1995): 618-619.
Source
scival
Published In
Journal of Virology
Volume
69
Issue
1
Publish Date
1995
Start Page
618
End Page
619

Selection of a subset of mRNAs from combinatorial 3' untranslated region libraries using neuronal RNA-binding protein Hel-N1.

Hel-N1, a human RNA-binding protein, shares significant homology with Drosophila protein ELAV, which is essential for fly neuronal development. Hel-N1 has been shown to bind in vitro to 3' untranslated regions of mRNAs encoding c-myc, c-fos, granulocyte/macrophage colony-stimulating factor, and transcriptional repressor, Id. We report that Hel-N1 and a related form, Hel-N2, are expressed in human medulloblastoma cells, but their ratio differs significantly from that in adult brain and fetal brain. Selection of RNA targets from randomized combinatorial libraries yielded (A+U)-rich consensus sequences for both Hel-N1 and Hel-N2. As a means to identify cellular RNA targets for these proteins, we devised combinatorial shape libraries representing naturally derived 3' untranslated regions and were able to select a structurally related subset of transcripts that bound to Hel-N1. Approximately 10% of the proteins encoded by these subset mRNAs were identifiable in the data bases and most are implicated in cell growth regulation. This approach provides a means to gain access to novel genes expressed in various cell types by partitioning mRNAs containing common sequence elements using RNA-binding proteins.

Authors
Gao, FB; Carson, CC; Levine, T; Keene, JD
MLA Citation
Gao, FB, Carson, CC, Levine, T, and Keene, JD. "Selection of a subset of mRNAs from combinatorial 3' untranslated region libraries using neuronal RNA-binding protein Hel-N1." Proc Natl Acad Sci U S A 91.23 (November 8, 1994): 11207-11211.
PMID
7972035
Source
pubmed
Published In
Proceedings of the National Academy of Sciences of USA
Volume
91
Issue
23
Publish Date
1994
Start Page
11207
End Page
11211

The U1 small nuclear ribonucleoprotein (snRNP) 70K protein is transported independently of U1 snRNP particles via a nuclear localization signal in the RNA-binding domain.

Expression of the recombinant human U1-70K protein in COS cells resulted in its rapid transport to the nucleus, even when binding to U1 RNA was debilitated. Deletion analysis of the U1-70K protein revealed the existence of two segments of the protein which were independently capable of nuclear localization. One nuclear localization signal (NLS) was mapped within the U1 RNA-binding domain and consists of two typically separated but interdependent elements. The major element of this NLS resides in structural loop 5 between the beta 4 strand and the alpha 2 helix of the folded RNA recognition motif. The C-terminal half of the U1-70K protein which was capable of nuclear entry contains two arginine-rich regions, which suggests the existence of a second NLS. Site-directed mutagenesis of the RNA recognition motif NLS demonstrated that the U1-70K protein can be transported independently of U1 RNA and that its association with the U1 small nuclear ribonucleoprotein particle can occur in the nucleus.

Authors
Romac, JM; Graff, DH; Keene, JD
MLA Citation
Romac, JM, Graff, DH, and Keene, JD. "The U1 small nuclear ribonucleoprotein (snRNP) 70K protein is transported independently of U1 snRNP particles via a nuclear localization signal in the RNA-binding domain." Mol Cell Biol 14.7 (July 1994): 4662-4670.
PMID
7516470
Source
pubmed
Published In
Molecular and Cellular Biology
Volume
14
Issue
7
Publish Date
1994
Start Page
4662
End Page
4670

60-kDa Ro protein autoepitopes identified using recombinant polypeptides.

The human Ro ribonucleoprotein is a clinically important yet poorly understood autoantigen. The contribution of Ro autoantibodies to pathogenesis of autoimmune disease remains unclear, as do the stimuli that initiate and maintain the response. Recent evidence suggests that patient anti-Ro responses target individual proteins, including a 60- and a 52-kDa species, within the complex in a disease-specific manner. However, Ro antisera retain considerable heterogeneity in their recognition of both continuous and discontinuous epitopes on the protein components. Previous characterization of Ro autoepitopes has primarily involved solid phase assays, which are of limited value in identifying discontinuous epitopes. To address the heterogeneity of Ro and the issue of discontinuous autoepitopes, we have generated 10 overlapping recombinant polypeptides of the human 60-kDa Ro protein and compared their reactivities using a soluble immunoprecipitation assay. Seven different epitopes, both continuous and discontinuous, were distinguished and seven distinct patterns of reactivity were discerned among the sera from 12 patients. These patterns of reactivity showed no relationship to clinical diagnosis but did correlate with the titer of Abs against recombinant 60-kDa Ro and with the concomitant presence of Abs directed against recombinant 52-kDa Ro protein. Sera that immunoprecipitated only the full-length 60-kDa protein had low or undetectable anti-60 kDa titers by ELISA and immunoblot using recombinant Ag, demonstrating a predominant recognition of discontinuous epitopes. These data indicate that autoantibody responses to the 60-kDa Ro Ag can preferentially target discontinuous epitopes and that the ability to recognize continuous epitopes is accompanied by the appearance of 52-kDa Ro autoantibodies.

Authors
Saitta, MR; Arnett, FC; Keene, JD
MLA Citation
Saitta, MR, Arnett, FC, and Keene, JD. "60-kDa Ro protein autoepitopes identified using recombinant polypeptides." J Immunol 152.8 (April 15, 1994): 4192-4202.
PMID
7511672
Source
pubmed
Published In
Journal of immunology (Baltimore, Md. : 1950)
Volume
152
Issue
8
Publish Date
1994
Start Page
4192
End Page
4202

Mammalian homologs of Drosophila ELAV localized to a neuronal subset can bind in vitro to the 3' UTR of mRNA encoding the Id transcriptional repressor.

Mammalian cDNAs encoding a rat (Rel-N1) and a human (Hel-N1) neuronal RNA-binding protein have been cloned and characterized with respect to tissue specificity, neuroanatomical localization, and RNA binding specificity. Both proteins are highly similar to the product of the Drosophila elav gene, which is expressed in all neurons of the fly and is required for development of the nervous system. However, in situ hybridization of rat tissues demonstrated more restricted expression of Rel-N1 mRNA within a subset of neurons of the hippocampus, cortex, and other regions of the gray matter, but not in glial cells or white matter. In vitro RNA binding experiments demonstrated that Hel-N1 can bind to the 3' untranslated region (3' UTR) of Id mRNA, a transcript that encodes a helix-loop-helix transcriptional repressor that is abundantly expressed in undifferentiated neural precursors. Sequences characterized for Hel-N1 binding were also abundantly present in the 3' UTR of the Drosophila extramacrochaetae mRNA, which encodes an Id homolog. Thus, we have identified a potential link between a neuronal 3' UTR RNA-binding protein and regulatory transcription factors involved in neural development. These findings are interpreted in light of recent studies in which mRNA 3' UTRs were found to be important for the regulation of cell growth and differentiation.

Authors
King, PH; Levine, TD; Fremeau, RT; Keene, JD
MLA Citation
King, PH, Levine, TD, Fremeau, RT, and Keene, JD. "Mammalian homologs of Drosophila ELAV localized to a neuronal subset can bind in vitro to the 3' UTR of mRNA encoding the Id transcriptional repressor." J Neurosci 14.4 (April 1994): 1943-1952.
PMID
8158249
Source
pubmed
Published In
The Journal of neuroscience : the official journal of the Society for Neuroscience
Volume
14
Issue
4
Publish Date
1994
Start Page
1943
End Page
1952

Molecular composition of Ro small ribonucleoprotein complexes in human cells. Intracellular localization of the 60- and 52-kD proteins.

Ro small ribonucleoprotein complexes (RoRNPs) are thought to comprise several proteins, including the 60-kD Ro and the 52-kD Ro proteins, and several small RNAs, designated Y RNAs. Although RoRNPs are fairly ubiquitous in nature, their precise composition remains unknown, their function has been elusive, and their intracellular localization has been controversial. We have analyzed HeLa cell extracts by glycerol density gradient fractionation in order to determine the distribution of the individual protein and RNA components of RoRNPs. We found that 52-kD Ro was not detectable in an RNP complex with the 60-kD protein under a variety of conditions. Pretreatment of cell extracts with ribonuclease affected gradient migration of the 60-kD but not the 52-kD protein, suggesting that the latter is not complexed with RNA. The migration of the hY RNAs in these gradients closely followed that of 60-kD and not 52-kD Ro. Immunofluorescence analysis of two different cell lines with monospecific antibodies against 52- and 60-kD proteins strongly suggests that these two proteins are not present on overlapping sets of structures in vivo. We conclude that the 52-kD Ro protein is not a detectable component of the RoRNP complex under these conditions despite its reactivity with Ro autoimmune antisera.

Authors
Kelekar, A; Saitta, MR; Keene, JD
MLA Citation
Kelekar, A, Saitta, MR, and Keene, JD. "Molecular composition of Ro small ribonucleoprotein complexes in human cells. Intracellular localization of the 60- and 52-kD proteins." J Clin Invest 93.4 (April 1994): 1637-1644.
PMID
7512986
Source
pubmed
Published In
Journal of Clinical Investigation
Volume
93
Issue
4
Publish Date
1994
Start Page
1637
End Page
1644
DOI
10.1172/JCI117145

Exploring molecular diversity with combinatorial shape libraries.

Surface technologies based upon selection of ligands from combinatorial libraries herald a revolution in molecular research and drug discovery. Molecular diversity is generated by random combinations of monomeric building blocks to form polymeric conformers that constitute 'shape libraries'. The media for exploring surfaces of target molecules include synthetic or biological polymers consisting of natural or modified amino acids, nucleotides, carbohydrates and other organic materials. Targets can be any biological surface, including enzymes, antibodies, receptors and other regulatory molecules. The power of combinatorial selection is in finding conceptual leads for designing high-affinity ligands and effector molecules for the analysis and manipulation of biochemical interactions.

Authors
Kenan, DJ; Tsai, DE; Keene, JD
MLA Citation
Kenan, DJ, Tsai, DE, and Keene, JD. "Exploring molecular diversity with combinatorial shape libraries." Trends Biochem Sci 19.2 (February 1994): 57-64. (Review)
PMID
8160266
Source
pubmed
Published In
Trends in Biochemical Sciences
Volume
19
Issue
2
Publish Date
1994
Start Page
57
End Page
64
DOI
10.1016/0968-0004(94)90033-7

Direct interactions between autoantigen La and human immunodeficiency virus leader RNA

We have characterized the in vivo and in vitro binding of human La protein to the human immunodeficiency virus type 1 (HIV-1) leader RNA, the trans- activation response element (TAR). In immunoprecipitation studies using anti- La serum, La-TAR ribonucleoproteins were recovered from HIV-1-infected lymphocytes. Further characterization of this interaction revealed that La has preference for the TAR stem. However, TAR RNA recognition tolerated changes in the primary sequence of the stem as long as the secondary structure was conserved. This structural aspect of La-TAR recognition was confirmed in competition studies in which certain homopolymers influenced complex formation while other single-stranded and double-stranded RNAs had no effect. Deletion mutants of recombinant La protein were used to demonstrate that the residues responsible for binding to polymerase III precursor transcripts overlapped the binding domain for the TAR leader RNA. This finding of a direct interaction between La and TAR has functional implications for translational regulation of HIV-1 mRNAs as demonstrated in the accompanying report (Y. V. Svitkin, A. Pause, and N. Sonenberg, J. Virol. 68:7001-7007, 1994).

Authors
Chang, Y-N; Kenan, DJ; Keene, JD; Gatignol, A; Jeang, K-T
MLA Citation
Chang, Y-N, Kenan, DJ, Keene, JD, Gatignol, A, and Jeang, K-T. "Direct interactions between autoantigen La and human immunodeficiency virus leader RNA." Journal of Virology 68.11 (1994): 7008-7020.
PMID
7933083
Source
scival
Published In
Journal of virology
Volume
68
Issue
11
Publish Date
1994
Start Page
7008
End Page
7020

Eukaryotic transcription termination factor La mediates transcript release and facilitates reinitiation by RNA polymerase III

Ample evidence indicates that Alu family interspersed elements retrotranspose via primary transcripts synthesized by RNA polymerase III (pol III) and that this transposition sometimes results in genetic disorders in humans. However, Alu primary transcripts can be processed posttranscriptionally, diverting them away from the transposition pathway. The pol III termination signal of a well-characterized murine B1 (Alu- equivalent) element inhibits RNA 3' processing, thereby stabilizing the putative transposition intermediary. We used an immobilized template-based assay to examine transcription termination by VA1, 7SL, and Alu class III templates and the role of transcript release in the pol III terminator- dependent inhibition of processing of B1-Alu transcripts. We found that the RNA-binding protein La confers this terminator-dependent 3' processing inhibition on transcripts released from the B1-Alu template. Using pure recombinant La protein and affinity-purified transcription complexes, we also demonstrate that La facilitates multiple rounds of transcription reinitiation by pol III. These results illustrate an important role for La in RNA production by demonstrating its ability to clear the termination sites of class III templates, thereby promoting efficient use of transcription complexes by pol III. The role of La as a potential regulatory factor in transcript maturation and how this might apply to Alu interspersed elements is discussed.

Authors
Maraia, RJ; Kenan, DJ; Keene, JD
MLA Citation
Maraia, RJ, Kenan, DJ, and Keene, JD. "Eukaryotic transcription termination factor La mediates transcript release and facilitates reinitiation by RNA polymerase III." Molecular and Cellular Biology 14.3 (1994): 2147-2158.
PMID
8114745
Source
scival
Published In
Molecular and Cellular Biology
Volume
14
Issue
3
Publish Date
1994
Start Page
2147
End Page
2158

Hel-N1: an autoimmune RNA-binding protein with specificity for 3' uridylate-rich untranslated regions of growth factor mRNAs.

We have investigated the RNA binding specificity of Hel-N1, a human neuron-specific RNA-binding protein, which contains three RNA recognition motifs. Hel-N1 is a human homolog of Drosophila melanogaster elav, which plays a vital role in the development of neurons. A random RNA selection procedure revealed that Hel-N1 prefers to bind RNAs containing short stretches of uridylates similar to those found in the 3' untranslated regions (3' UTRs) of oncoprotein and cytokine mRNAs such as c-myc, c-fos, and granulocyte macrophage colony-stimulating factor. Direct binding studies demonstrated that Hel-N1 bound and formed multimers with c-myc 3' UTR mRNA and required, as a minimum, a specific 29-nucleotide stretch containing AUUUG, AUUUA, and GUUUUU. Deletion analysis demonstrated that a fragment of Hel-N1 containing 87 amino acids, encompassing the third RNA recognition motif, forms an RNA binding domain for the c-myc 3' UTR. In addition, Hel-N1 was shown to be reactive with autoantibodies from patients with paraneoplastic encephalomyelitis both before and after binding to c-myc mRNA.

Authors
Levine, TD; Gao, F; King, PH; Andrews, LG; Keene, JD
MLA Citation
Levine, TD, Gao, F, King, PH, Andrews, LG, and Keene, JD. "Hel-N1: an autoimmune RNA-binding protein with specificity for 3' uridylate-rich untranslated regions of growth factor mRNAs." Mol Cell Biol 13.6 (June 1993): 3494-3504.
PMID
8497264
Source
pubmed
Published In
Molecular and Cellular Biology
Volume
13
Issue
6
Publish Date
1993
Start Page
3494
End Page
3504

In vitro selection of RNA epitopes using autoimmune patient serum.

Nucleotide-specific autoimmune epitopes have not been precisely defined despite the fact that certain kinds of DNA and RNA species are known to bind autoantibodies. Our laboratory has used nucleic acid epitope libraries, consisting of randomized RNA pools, to select specific RNA conformers recognized by antibodies, including a peptide-specific antibody. In the present study, serum from a patient with systemic lupus erythematosus was used to select ligands from an RNA epitope library. The selected RNA contained sequences that were found to be similar to regions within the U1 small nuclear RNA, previously shown to react with autoantibodies. Furthermore, the selected RNA epitopes were able to inhibit autoantibody reactivity with specific regions of U1 RNA, thus demonstrating their immunologic cross-reactivity with the natural RNA epitope. Although the origins of nucleic acid-binding autoantibodies are not understood, the identification of these defined U1 RNA epitopes, in regions of the RNA where cell proteins are not known to bind, is most compatible with models of immunologic cross-reactivity or with direct presentation to the immune system rather than with anti-Id models. These experiments demonstrate that RNA epitope libraries may be used to reveal the fine specificity of autoimmune recognition and provide a useful approach to study RNA-protein interactions.

Authors
Tsai, DE; Keene, JD
MLA Citation
Tsai, DE, and Keene, JD. "In vitro selection of RNA epitopes using autoimmune patient serum." J Immunol 150.3 (February 1, 1993): 1137-1145.
PMID
7678618
Source
pubmed
Published In
Journal of immunology (Baltimore, Md. : 1950)
Volume
150
Issue
3
Publish Date
1993
Start Page
1137
End Page
1145

La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate

Translation initiation on poliovirus RNA occurs by internal binding of ribosomes to a sequence within the 5′ untranslated region. We have previously characterized a HeLa cell protein, p52, that binds to a fragment of the poliovirus 5′ untranslated region (K. Meerovitch, J. Pelletier, and N. Sonenberg, Genes Dev. 3:1026-1034, 1989). Here we report the purification of the HeLa p52. Protein microsequencing identified p52 as La autoantigen. The La protein is a human antigen that is recognized by antibodies from patients with autoimmune disorders such as systemic lupus erythematosus and Sjögren's syndrome. We show that the La protein stimulates translation of poliovirus RNA, but not brome mosaic virus, tobacco mosaic virus, and alfalfa mosaic virus 4 RNA, translation in a reticulocyte lysate. In addition, La corrects aberrant translation of poliovirus RNA in a reticulocyte lysate. Subcellular immunolocalization showed that La protein is mainly nuclear, but after poliovirus infection, La is redistributed to the cytoplasm. Our results suggest that La protein is involved in poliovirus internal initiation of translation and might function through a similar mechanism in the translation of cellular mRNAs.

Authors
Meerovitch, K; Svitkin, YV; Lee, HS; Lejbkowicz, F; Kenan, DJ; Chan, EKL; Agol, VI; Keene, JD; Sonenberg, N
MLA Citation
Meerovitch, K, Svitkin, YV, Lee, HS, Lejbkowicz, F, Kenan, DJ, Chan, EKL, Agol, VI, Keene, JD, and Sonenberg, N. "La autoantigen enhances and corrects aberrant translation of poliovirus RNA in reticulocyte lysate." Journal of Virology 67.7 (1993): 3798-3807.
PMID
8389906
Source
scival
Published In
Journal of Virology
Volume
67
Issue
7
Publish Date
1993
Start Page
3798
End Page
3807

In vitro selection of an RNA epitope immunologically cross-reactive with a peptide.

An antiserum raised against a peptide was used to select a unique RNA species from a degenerate pool of RNAs designed to resemble an autoantibody recognition site in U1 RNA. The peptide and the selected RNA epitope could compete for antibody binding, suggesting that both RNA and peptide epitopes occupy the same or overlapping antigen-combining sites. Thus, the RNA epitope functioned as a specific inhibitor of the antibody-antigen interaction. We demonstrate that the RNA epitope can be used to tag unrelated RNA molecules and also to detect the presence of the antibody. We propose that sequence-specific recognition of RNA by antibodies may involve protein-RNA contacts similar to those occurring in other nucleic acid-binding proteins. In addition, these findings are compatible with the suggestion that nucleic acid-binding autoantibodies may arise through immunological cross-reactivity between proteins and nucleic acids.

Authors
Tsai, DE; Kenan, DJ; Keene, JD
MLA Citation
Tsai, DE, Kenan, DJ, and Keene, JD. "In vitro selection of an RNA epitope immunologically cross-reactive with a peptide." Proc Natl Acad Sci U S A 89.19 (October 1, 1992): 8864-8868.
PMID
1384035
Source
pubmed
Published In
Proceedings of the National Academy of Sciences of USA
Volume
89
Issue
19
Publish Date
1992
Start Page
8864
End Page
8868

RNA binding specificity of a Drosophila snRNP protein that shares sequence homology with mammalian U1-A and U2-B" proteins.

We have characterized a recombinant Drosophila melanogaster RNA binding protein, D25, by virtue of its antigenic relationship to mammalian U1 and U2 small nuclear ribonucleoprotein (U snRNP) proteins. Sequence analysis revealed that D25 bears strong similarity to both the human U1 snRNP-A (U1-A) and U2 snRNP-B" (U2-B") proteins. However, at residues known to be critical for the RNA binding specificities of U1-A and U2-B" D25 sequence is more similar to U2-B". Using direct RNA binding assays D25 selected U1 RNA from either HeLa or Drosophila Kc cell total RNA. Furthermore, D25 bound U1 RNA when transfected into mammalian cells. Thus, D25 appears to be a Drosophila homolog of the mammalian U1-A protein, despite its sequence similarity to U2-B".

Authors
Harper, DS; Fresco, LD; Keene, JD
MLA Citation
Harper, DS, Fresco, LD, and Keene, JD. "RNA binding specificity of a Drosophila snRNP protein that shares sequence homology with mammalian U1-A and U2-B" proteins." Nucleic Acids Res 20.14 (July 25, 1992): 3645-3650.
PMID
1386424
Source
pubmed
Published In
Nucleic Acids Research
Volume
20
Issue
14
Publish Date
1992
Start Page
3645
End Page
3650

Molecular biology of nuclear autoantigens.

This article provides a historical overview of the application of molecular and immunologic techniques to the analysis of autoantigenic structure and function, as well as to autoantibody recognition of protein and nucleic acid autoantigens. Examples presented here illustrate the role of autoantibodies as tools in the elucidation of the autoimmune components of cellular ribonucleoproteins. In turn, the subsequent molecular dissection of autoantigenic ribonucleoproteins has advanced understanding of autoantibody specificities. The nature of autoantibodies reactive with various proteins and nucleic acids will be the subject of the following articles in this issue. Taken together, these studies of antibody-antigen interactions that arise during the autoimmune response have revealed novel mechanisms of molecular recognition within the RNP autoantigens. These findings are of general importance for understanding basic cellular processes and have contributed to our knowledge of the underlying mechanisms of immunoregulatory abnormalities that arise in autoimmune diseases.

Authors
Saitta, MR; Keene, JD
MLA Citation
Saitta, MR, and Keene, JD. "Molecular biology of nuclear autoantigens." Rheum Dis Clin North Am 18.2 (May 1992): 283-310. (Review)
PMID
1626070
Source
pubmed
Published In
Rheumatic Disease Clinics of North America
Volume
18
Issue
2
Publish Date
1992
Start Page
283
End Page
310

U1-snRNP-A protein selects a ten nucleotide consensus sequence from a degenerate RNA pool presented in various structural contexts.

The U1snRNP-A (U1-A) protein was used to select specific RNA sequences from a degenerate pool of transcripts using direct RNA binding and polymerase chain reaction amplification (PCR). Sequences were randomized in loops of 10 or 13 nucleotides or as a linear stretch of 25 nucleotides. From all three structural contexts, an unpaired ten nucleotide consensus sequence was obtained. A selected stem-loop structure that resembled the natural U1-A protein binding site on loop II of U1 RNA demonstrated the highest affinity of binding in comparison with the other structural contexts. A data profile of selected sequences identified U1 RNA upon searching the GenBank database. Thus, this method was useful in determining the sequence specificity of an RNA binding protein and may complement the use of phylogenetic comparisons to predict conserved recognition elements. These findings also suggest that the evolutionary conservation of loop II of U1 RNA results from constraints imposed by protein binding.

Authors
Tsai, DE; Harper, DS; Keene, JD
MLA Citation
Tsai, DE, Harper, DS, and Keene, JD. "U1-snRNP-A protein selects a ten nucleotide consensus sequence from a degenerate RNA pool presented in various structural contexts." Nucleic Acids Res 19.18 (September 25, 1991): 4931-4936.
PMID
1717938
Source
pubmed
Published In
Nucleic Acids Research
Volume
19
Issue
18
Publish Date
1991
Start Page
4931
End Page
4936

RNA recognition: towards identifying determinants of specificity.

Members of a family of proteins containing a conserved approximately 80-amino acid RNA recognition motif (RRM) bind specifically to a wide variety of RNA molecules. Structural studies, in combination with sequence alignments, indicate the structural context of both conserved and non-conserved elements in the motif. These analyses suggest that all RRM proteins share a common fold and a similar protein-RNA interface, and that non-conserved residues contribute additional contacts for sequence-specific RNA recognition.

Authors
Kenan, DJ; Query, CC; Keene, JD
MLA Citation
Kenan, DJ, Query, CC, and Keene, JD. "RNA recognition: towards identifying determinants of specificity." Trends Biochem Sci 16.6 (June 1991): 214-220.
PMID
1716386
Source
pubmed
Published In
Trends in Biochemical Sciences
Volume
16
Issue
6
Publish Date
1991
Start Page
214
End Page
220

Recognition of U1 and U2 small nuclear RNAs can be altered by a 5-amino-acid segment in the U2 small nuclear ribonucleoprotein particle (snRNP) B" protein and through interactions with U2 snRNP-A' protein.

We have investigated the sequence elements influencing RNA recognition in two closely related small nuclear ribonucleoprotein particle (snRNP) proteins, U1 snRNP-A and U2 snRNP-B". A 5-amino-acid segment in the RNA-binding domain of the U2 snRNP-B" protein was found to confer U2 RNA recognition when substituted into the corresponding position in the U1 snRNP-A protein. In addition, B", but not A, was found to require the U2 snRNP-A' protein as an accessory factor for high-affinity binding to U2 RNA. The pentamer segment in B" that conferred U2 RNA recognition was not sufficient to allow the A' enhancement of U2 RNA binding by B", thus implicating other sequences in this protein-protein interaction. Sequence elements involved in these interactions have been localized to variable loops of the RNA-binding domain as determined by nuclear magnetic resonance spectroscopy (D. Hoffman, C.C. Query, B. Golden, S.W. White, and J.D. Keene, Proc. Natl. Acad. Sci. USA, in press). These findings suggest a role for accessory proteins in the formation of RNP complexes and pinpoint amino acid sequences that affect the specificity of RNA recognition in two members of a large family of proteins involved in RNA processing.

Authors
Bentley, RC; Keene, JD
MLA Citation
Bentley, RC, and Keene, JD. "Recognition of U1 and U2 small nuclear RNAs can be altered by a 5-amino-acid segment in the U2 small nuclear ribonucleoprotein particle (snRNP) B" protein and through interactions with U2 snRNP-A' protein." Mol Cell Biol 11.4 (April 1991): 1829-1839.
PMID
1826042
Source
pubmed
Published In
Molecular and Cellular Biology
Volume
11
Issue
4
Publish Date
1991
Start Page
1829
End Page
1839

Anti-La antibody production by MRL-1pr/1pr mice. Analysis of fine specificity.

In evaluating the origin of autoantibodies, patterns of self-Ag recognition have been interpreted to reflect the relative role of Ag in stimulating a response. Few studies, however, have assessed whether human autoantibodies display patterns of autoantigen recognition similar to those of SLE-prone mice. In previous studies, anti-La antibodies from humans have been shown to bind multiple epitopes on recombinant human La Ag, including immunoreactivity with a large fragment, termed La C, representing the middle portion of the La sequence. We report herein for the first time that MRL-1pr mice also spontaneously produce antibodies to recombinant human La protein and resemble human autoantibodies in their reactivity with La C. To further investigate the fine specificity of this response, we tested for antibody binding to six synthetic La peptides representing sequences within La C. Whereas two of the synthetic La peptides reacted with MRL-1pr sera containing anti-La binding, low reactivity was observed with a large panel of human anti-La sera. Our results therefore show that patterns of La antigen recognition displayed by MRL-1pr antibodies differ from those of human autoantibodies, possibly reflecting differences between mouse and man in the induction of these responses.

Authors
St Clair, EW; Kenan, D; Burch, JA; Keene, JD; Pisetsky, DS
MLA Citation
St Clair, EW, Kenan, D, Burch, JA, Keene, JD, and Pisetsky, DS. "Anti-La antibody production by MRL-1pr/1pr mice. Analysis of fine specificity." J Immunol 146.6 (March 15, 1991): 1885-1892.
PMID
2005384
Source
pubmed
Published In
Journal of immunology (Baltimore, Md. : 1950)
Volume
146
Issue
6
Publish Date
1991
Start Page
1885
End Page
1892

RNA-binding domain of the A protein component of the U1 small nuclear ribonucleoprotein analyzed by NMR spectroscopy is structurally similar to ribosomal proteins.

An RNA recognition motif (RRM) of approximately 80 amino acids constitutes the core of RNA-binding domains found in a large family of proteins involved in RNA processing. The U1 RNA-binding domain of the A protein component of the human U1 small nuclear ribonucleoprotein (RNP), which encompasses the RRM sequence, was analyzed by using NMR spectroscopy. The domain of the A protein is a highly stable monomer in solution consisting of four antiparallel beta-strands and two alpha-helices. The highly conserved RNP1 and RNP2 consensus sequences, containing residues previously suggested to be involved in nucleic acid binding, are juxtaposed in adjacent beta-strands. Conserved aromatic side chains that are critical for RNA binding are clustered on the surface of the molecule adjacent to a variable loop that influences recognition of specific RNA sequences. The secondary structure and topology of the RRM are similar to those of ribosomal proteins L12 and L30, suggesting a distant evolutionary relationship between these two types of RNA-associated proteins.

Authors
Hoffman, DW; Query, CC; Golden, BL; White, SW; Keene, JD
MLA Citation
Hoffman, DW, Query, CC, Golden, BL, White, SW, and Keene, JD. "RNA-binding domain of the A protein component of the U1 small nuclear ribonucleoprotein analyzed by NMR spectroscopy is structurally similar to ribosomal proteins." Proc Natl Acad Sci U S A 88.6 (March 15, 1991): 2495-2499.
PMID
1826055
Source
pubmed
Published In
Proceedings of the National Academy of Sciences of USA
Volume
88
Issue
6
Publish Date
1991
Start Page
2495
End Page
2499

Leucine periodicity of U2 small nuclear ribonucleoprotein particle (snRNP) A' protein is implicated in snRNP assembly via protein-protein interactions.

Recombinant A' protein could be reconstituted into U2 small nuclear ribonucleoprotein particles (snRNPs) upon addition to HeLa cell extracts as determined by coimmunoprecipitation and particle density; however, direct binding to U2 RNA could not be demonstrated except in the presence of the U2 snRNP B" protein. Mutational analysis indicated that a central core region of A' was required for particle reconstitution. This region consists of five tandem repeats of approximately 24 amino acids each that exhibit a periodicity of leucine and asparagine residues that is distinct from the leucine zipper. Similar leucine-rich (Leu-Leu motif) repeats are characteristic of a diverse array of soluble and membrane-associated proteins from yeasts to humans but have not been reported previously to reside in nuclear proteins. Several of these proteins, including Toll, chaoptin, RNase/angiogenin inhibitors, lutropin-choriogonadotropin receptor, carboxypeptidase N, adenylyl cyclase, CD14, and human immunodeficiency virus type 1 Rev, may be involved in protein-protein interactions. Our findings suggest that in cell extracts the Leu-Leu motif of A' is required for reconstitution with U2 snRNPs and perhaps with other components involved in splicing through protein-protein interactions.

Authors
Fresco, LD; Harper, DS; Keene, JD
MLA Citation
Fresco, LD, Harper, DS, and Keene, JD. "Leucine periodicity of U2 small nuclear ribonucleoprotein particle (snRNP) A' protein is implicated in snRNP assembly via protein-protein interactions." Mol Cell Biol 11.3 (March 1991): 1578-1589.
PMID
1825347
Source
pubmed
Published In
Molecular and Cellular Biology
Volume
11
Issue
3
Publish Date
1991
Start Page
1578
End Page
1589

Molecular cloning of a cDNA of a camptothecin-resistant human DNA topoisomerase I and identification of mutation sites

Camptothecin (CPT), a plant alkaloid with antitumor activity, is a specific inhibitor of eukaryotic DNA topoisomerase I. We have previously isolated and characterized a CPT-resistant topoisomerase I isolated from a CPT-resistant human leukemia cell line, CPT-K5. cDNA clones of topoisomerase I were isolated from the CPT-resistant and the parental CPT-sensitive cell lines, respectively. Sequencing of the clones identified two mutations in the cDNA isolated from the resistant cells, which cause amino acid changes from aspartic acid to glycine at residues 533 and 583 of the parental topoisomerase I. When the CPT-K5 topoisomerase I was expressed in E. coli as a fusion protein with Staphylococcal Protein A fragment, the activity was resistant to CPT at a dose level up to 125 μM, whereas the parental fusion protein was sensitive to CPT as low as 1 μM. The resistance index (>125) of the CPT-K5 fusion topoisomerase I is similar to that of the native CPT-K5 topoisomerase I. These results indicate that either or both of the two amino acid changes identified in the mutant enzyme is responsible for the resistance to CPT.

Authors
Tamura, H-O; Kohchi, C; Yamada, R; Ikeda, T; Koiwai, O; Patterson, E; Keene, JD; Okada, K; Kjeldsen, E; Nishikawa, K; Andoh, T
MLA Citation
Tamura, H-O, Kohchi, C, Yamada, R, Ikeda, T, Koiwai, O, Patterson, E, Keene, JD, Okada, K, Kjeldsen, E, Nishikawa, K, and Andoh, T. "Molecular cloning of a cDNA of a camptothecin-resistant human DNA topoisomerase I and identification of mutation sites." Nucleic Acids Research 19.1 (1991): 69-75.
PMID
1849260
Source
scival
Published In
Nucleic Acids Research
Volume
19
Issue
1
Publish Date
1991
Start Page
69
End Page
75

Nuclear RNA-binding proteins.

Authors
Keene, JD; Query, CC
MLA Citation
Keene, JD, and Query, CC. "Nuclear RNA-binding proteins." Prog Nucleic Acid Res Mol Biol 41 (1991): 179-202. (Review)
PMID
1715588
Source
pubmed
Published In
Progress in nucleic acid research and molecular biology
Volume
41
Publish Date
1991
Start Page
179
End Page
202

Quantitative determination that one of two potential RNA-binding domains of the A protein component of the U1 small nuclear ribonucleoprotein complex binds with high affinity to stem-loop II of U1 RNA.

Many RNA-associated proteins contain a ribonucleoprotein (RNP) consensus octamer encompassed by a conserved 80 amino acid sequence, which we have termed an RNA recognition motif (RRM). RRM family members contain either one (class I) or multiple (class II) copies of this motif. We report here that a class II component of the U1 small nuclear RNP (snRNP), the A protein of U1 snRNP (U1snRNP-A), contains two RRMs (RRM1 and -2), yet has only one binding domain (RRM1) that interacts specifically with stem-loop II of U1 RNA. Quantitative analysis of binding affinities of fragments of U1snRNP-A demonstrated that an 86-amino acid polypeptide was competent to bind to U1 RNA with an affinity comparable to that of the full-length protein (Kd approximately 80 nM). The carboxyl-terminal RRM2 of U1snRNP-A did not bind to U1 RNA and may recognize an unidentified heterologous RNA. We propose that class II proteins may function as bridges between RNA components of RNP complexes such as the spliceosome.

Authors
Lutz-Freyermuth, C; Query, CC; Keene, JD
MLA Citation
Lutz-Freyermuth, C, Query, CC, and Keene, JD. "Quantitative determination that one of two potential RNA-binding domains of the A protein component of the U1 small nuclear ribonucleoprotein complex binds with high affinity to stem-loop II of U1 RNA." Proc Natl Acad Sci U S A 87.16 (August 1990): 6393-6397.
PMID
1696729
Source
pubmed
Published In
Proceedings of the National Academy of Sciences of USA
Volume
87
Issue
16
Publish Date
1990
Start Page
6393
End Page
6397

The fine specificity of anti-La antibodies induced in mice by immunization with recombinant human La autoantigen.

Because of increasing evidence suggesting that anti-La autoantibodies are induced in humans by an Ag-specific mechanism, we investigated the antibody response of animals immunized with the human La Ag and studied its relationship to the anti-La response of autoimmune patients. Anti-La antibodies were raised in 6- to 8-wk-old male MRL(-)+/+, C57BL/6J, BALB/c, and A/J mice by immunizing with authentic human La protein obtained by recombinant expression in Escherichia coli. As we have shown previously for human autoantibodies, induced mouse anti-La antibodies reacted with recombinant fusion proteins containing nonoverlapping sequences from different portions of the La molecule. The epitope specificity of antibodies to the middle region of the La Ag was further evaluated using six synthetic La peptides predicted to be antigenic based on their hydrophilic properties. Although the induced mouse anti-La antibodies bound to five of the six synthetic La peptides, human anti-La autoantibodies failed to recognize any of the peptide homologs. These results suggest that mice respond to immunization with human La protein differently than humans who develop autoimmunity to this self Ag.

Authors
St Clair, EW; Kenan, D; Burch, JA; Keene, JD; Pisetsky, DS
MLA Citation
St Clair, EW, Kenan, D, Burch, JA, Keene, JD, and Pisetsky, DS. "The fine specificity of anti-La antibodies induced in mice by immunization with recombinant human La autoantigen." J Immunol 144.10 (May 15, 1990): 3868-3876.
PMID
1692063
Source
pubmed
Published In
Journal of immunology (Baltimore, Md. : 1950)
Volume
144
Issue
10
Publish Date
1990
Start Page
3868
End Page
3876

Expression of autoantibodies to recombinant (U1) RNP-associated 70K antigen in systemic lupus erythematosus.

To determine the specificity of antibodies to the (U1) ribonucleoprotein antigen in systemic lupus erythematosus (SLE), patient sera were tested for binding to a recombinant human 70K antigen. By solid-phase immunoassay, we detected anti-70K reactivity in sera from 31 of 96 patients with systemic lupus erythematosus (SLE), demonstrating that anti-70K antibodies may occur in patients with SLE as well as other clinical diagnoses. In sequential sera from 2 of these patients, we found that anti-70K binding varied dramatically over the course of disease. The changes in anti-70K antibody levels did not correlate with clinical events nor evolving antibody reactivity with the Sm-specific antigens.

Authors
St Clair, EW; Query, CC; Bentley, R; Keene, JD; Polisson, RP; Allen, NB; Caldwell, DS; Rice, JR; Cox, C; Pisetsky, DS
MLA Citation
St Clair, EW, Query, CC, Bentley, R, Keene, JD, Polisson, RP, Allen, NB, Caldwell, DS, Rice, JR, Cox, C, and Pisetsky, DS. "Expression of autoantibodies to recombinant (U1) RNP-associated 70K antigen in systemic lupus erythematosus." Clin Immunol Immunopathol 54.2 (February 1990): 266-280.
PMID
2104788
Source
pubmed
Published In
Clinical Immunology and Immunopathology
Volume
54
Issue
2
Publish Date
1990
Start Page
266
End Page
280

Temporal correlation of antibody responses to different epitopes of the human La autoantigen.

To investigate the temporal relationship of antibody responses to different La epitopes, sequential sera from nine patients with systemic lupus erythematosus and Sjogren's syndrome were tested by enzyme-linked immunosorbent assay for antibody binding to a series of recombinant fusion proteins containing different regions of the La molecule. The results of this analysis indicate that antibody responses to four different La fragments vary in parallel over time. This finding is supported by a statistical analysis indicating that the changes in antibody levels between the six pairs of responses were highly correlated (P less than 0.001). Furthermore, we show by immunoaffinity purification that antibodies to the three nonoverlapping La protein fragments do not cross-react with other fragments and, hence, represent independent populations. These results suggest that anti-La antibodies are coordinately produced to different epitopes on the La molecule, possibly reflecting an antigen-driven mechanism.

Authors
St Clair, EW; Burch, JA; Ward, MM; Keene, JD; Pisetsky, DS
MLA Citation
St Clair, EW, Burch, JA, Ward, MM, Keene, JD, and Pisetsky, DS. "Temporal correlation of antibody responses to different epitopes of the human La autoantigen." J Clin Invest 85.2 (February 1990): 515-521.
PMID
1688887
Source
pubmed
Published In
Journal of Clinical Investigation
Volume
85
Issue
2
Publish Date
1990
Start Page
515
End Page
521
DOI
10.1172/JCI114467

Characterization of a Drosophila U snRNP RNA-binding protein.

Authors
Harper, DS; Fresco, LD; Keene, JD
MLA Citation
Harper, DS, Fresco, LD, and Keene, JD. "Characterization of a Drosophila U snRNP RNA-binding protein." Mol Biol Rep 14.2-3 (1990): 163-.
PMID
2141901
Source
pubmed
Published In
Molecular Biology Reports
Volume
14
Issue
2-3
Publish Date
1990
Start Page
163

Downregulation of RNA polymerase III transcription of the hY3 gene in vitro.

Authors
Kelekar, A; Keene, JD
MLA Citation
Kelekar, A, and Keene, JD. "Downregulation of RNA polymerase III transcription of the hY3 gene in vitro." Mol Biol Rep 14.2-3 (1990): 173-174.
PMID
2362573
Source
pubmed
Published In
Molecular Biology Reports
Volume
14
Issue
2-3
Publish Date
1990
Start Page
173
End Page
174

Antigenicity of a recombinant Ro (SS-A) fusion protein

The antigenicity of the 60-kd human Ro (SS-A) synthesized in vitro from its complementary DNA as a β-galactosidase fusion protein (β-gal-Ro) was evaluated by Western blotting. In this analysis, almost all the anti-Ro (SS-A)-positive sera that bound β-gal-Ro also bound affinity-purified 60-kd human Ro (SS-A) (P < 0.005). Three of the 27 anti-Ro (SS-A) precipitin-positive sera, however, did not show reactivity on Western blot analysis, which suggests that in some sera, antigenicity to Ro (SS-A) is destroyed by denaturation. Of the 22 sera that were reactive with β-gal-Ro, 2 were not reactive with affinity-purified human Ro (SS-A). Two serum samples that did not react with β-gal-Ro were also reactive with affinity-purified human Ro (SS-A). Nevertheless, except for a small percentage of Ro (SS-A) precipitin-positive sera, the frequency of antibody binding to the fusion protein was similar to the frequency of binding to the purified antigen in Western blots. Recombinant Ro (SS-A) antigen may therefore be valuable in the serologic evaluation of anti-Ro (SS-A) autoantibodies.

Authors
James, JA; Dickey, WD; Fujisaku, A; O'Brien, CA; Deutscher, SL; Keene, JD; Harley, JB
MLA Citation
James, JA, Dickey, WD, Fujisaku, A, O'Brien, CA, Deutscher, SL, Keene, JD, and Harley, JB. "Antigenicity of a recombinant Ro (SS-A) fusion protein." Arthritis and Rheumatism 33.1 (1990): 102-106.
PMID
1689160
Source
scival
Published In
Arthritis and Rheumatism
Volume
33
Issue
1
Publish Date
1990
Start Page
102
End Page
106
DOI
10.1002/art.1780330114

A three allele TaqI polymorphism at TOP1 gene

Authors
Sunde, L; Kjeldsen, E; Andoh, T; Keene, JD; Bolund, L
MLA Citation
Sunde, L, Kjeldsen, E, Andoh, T, Keene, JD, and Bolund, L. "A three allele TaqI polymorphism at TOP1 gene." Nucleic Acids Research 18.19 (1990): 5919--.
Source
scival
Published In
Nucleic Acids Research
Volume
18
Issue
19
Publish Date
1990
Start Page
5919-

A specific 31-nucleotide domain of U1 RNA directly interacts with the 70K small nuclear ribonucleoprotein component.

We have defined the nucleotide sequence of a protein-binding domain within U1 RNA that specifically recognizes and binds both to a U1 small nuclear ribonucleoprotein component (the 70K protein) and to the previously defined RNA-binding domain of the 70K protein. We have investigated direct interactions between purified U1 RNA and 70K protein by reconstitution in vitro. Thirty-one nucleotides of U1 RNA, corresponding to stem-loop I, were required for this interaction. Nucleotides at the 5' end of U1 RNA that are involved in base pairing with the 5' splice site of pre-mRNA were not required for binding. In contrast to other reports, these findings demonstrate that a specific domain of U1 RNA can bind directly to the 70K protein independently of any other snRNP-associated proteins.

Authors
Query, CC; Bentley, RC; Keene, JD
MLA Citation
Query, CC, Bentley, RC, and Keene, JD. "A specific 31-nucleotide domain of U1 RNA directly interacts with the 70K small nuclear ribonucleoprotein component." Mol Cell Biol 9.11 (November 1989): 4872-4881.
PMID
2532301
Source
pubmed
Published In
Molecular and Cellular Biology
Volume
9
Issue
11
Publish Date
1989
Start Page
4872
End Page
4881

Viral transcription is necessary and sufficient for vesicular stomatitis virus to inhibit maturation of small nuclear ribonucleoproteins.

Infection of baby hamster kidney cells with vesicular stomatitis virus (VSV) results in the accumulation of immature U1 and U2 small nuclear ribonucleoproteins (snRNPs) that contain precursor U RNAs and at least some of the proteins specific for U1 and U2 snRNAs but lack the Sm complex of proteins that is common to these U snRNAs. The VSV function required for this effect is not known, but direct inhibition of cellular transcription did not alter the maturation of U1 and U2 snRNPs. On the other hand, viral transcription but not viral translation was required to inhibit U1 and U2 snRNP maturation. Temperature shift experiments with the mutant G114 showed that ongoing viral transcription was necessary, but that viral mRNA was not required for this inhibition. Furthermore, the VSV function involved in the inhibition of maturation of U1 and U2 snRNPs had a small UV target size of approximately 10 to 20 nucleotides. We demonstrate that temperature-sensitive mutants of VSV can be used as a tool to initiate the assembly of snRNPs in infected cells. These results are compatible with the suggestion that perturbation of snRNP metabolism by VSV precedes and is distinct from the effect of VSV on cellular RNA synthesis, although VSV leader RNA may be involved in both these functions.

Authors
Crone, DE; Keene, JD
MLA Citation
Crone, DE, and Keene, JD. "Viral transcription is necessary and sufficient for vesicular stomatitis virus to inhibit maturation of small nuclear ribonucleoproteins." J Virol 63.10 (October 1989): 4172-4180.
PMID
2550663
Source
pubmed
Published In
Journal of virology
Volume
63
Issue
10
Publish Date
1989
Start Page
4172
End Page
4180

Inhibitory effects of vesicular stomatitis virus on cellular and influenza viral RNA metabolism and protein synthesis.

Infection with vesicular stomatitis virus (VSV) results in the rapid inhibition of cellular macromolecular synthesis, including transcription, translation, and maturation of the U1 and U2 snRNPs. Unlike infection with VSV, influenza virus infection did not result in the inhibition of either the processing of U1 and U2 snRNAs or the assembly of the RNPs. Although influenza virus relies on the cellular splicing apparatus to generate viral mRNAs, the maturation of snRNPs was inhibited during double infections with VSV. However, this inhibition of snRNP maturation had no effect on the splicing of a cellular pre mRNA in extracts prepared from VSV-infected HeLa cells. Thus, the effects of VSV on the processing and assembly of snRNPs appear to involve virus-specific functions and unique cellular targets. Coinfection with VSV and influenza virus resulted in the dramatic inhibition of influenza virus transcription; polyadenylated mRNAs corresponding to the influenza virus NP and NS1 proteins could not be detected by Northern blot analysis. However, reduced levels of the influenza virus replicative templates were still synthesized during double infection. Coinfection with VSV also resulted in the inhibition of influenza viral mRNA translation, even when superinfection with VSV was delayed until 3 or 6 hr after influenza virus infection. VSV required at least 2 hr to affect the inhibition of translation; this corresponded to the time after VSV infection when inhibition of cellular protein synthesis was evident. These results demonstrate that, in contrast to adenovirus, the VSV-mediated inhibition of cellular macromolecular synthesis may be effective against influenza virus.

Authors
Frielle, DW; Kim, PB; Keene, JD
MLA Citation
Frielle, DW, Kim, PB, and Keene, JD. "Inhibitory effects of vesicular stomatitis virus on cellular and influenza viral RNA metabolism and protein synthesis." Virology 172.1 (September 1989): 274-284.
PMID
2549715
Source
pubmed
Published In
Virology
Volume
172
Issue
1
Publish Date
1989
Start Page
274
End Page
284

Epitope specificity of anti-La antibodies from patients with Sjögren's syndrome.

To investigate patterns of autoreactivity in Sjögren's syndrome, the epitope specificity of anti-La antibodies was determined using recombinant antigens bearing sequences of the amino, middle, and carboxyl portions of the La molecule. Sera from patients with primary as well as secondary Sjögren's syndrome reacted with all three fragments, although the magnitude of the responses varied markedly among individuals. Furthermore, the proportion of antibody binding directed to the different La epitopes showed considerable individual variations, but these patterns were not correlated with specific clinical manifestations. These results suggest that quantitative and qualitative aspects of anti-La responses in Sjögren's syndrome are determined by factors distinct from those determining the clinical expression of disease.

Authors
St Clair, EW; Talal, N; Moutsopoulos, HM; Ballester, A; Zerva, L; Keene, JD; Pisetsky, DS
MLA Citation
St Clair, EW, Talal, N, Moutsopoulos, HM, Ballester, A, Zerva, L, Keene, JD, and Pisetsky, DS. "Epitope specificity of anti-La antibodies from patients with Sjögren's syndrome." J Autoimmun 2.4 (August 1989): 335-344.
PMID
2477000
Source
pubmed
Published In
Journal of Autoimmunity
Volume
2
Issue
4
Publish Date
1989
Start Page
335
End Page
344

Molecular structure of the La and Ro autoantigens and their use in autoimmune diagnostics.

Recombinant autoantigens of the La and Ro specificities have been produced and analyzed using immunological and genetic techniques. Human La cDNA and genomic clones were isolated that encode a protein of 46.7 kDa (408 amino acids). An active La gene consisting of 11 exons was localized on chromosome 2 and has an upstream transcriptional regulatory region resembling 'housekeeping' genes as well as elements homologous to the H-ras gene promoter which is presumably a 'regulated' gene. A long stretch of alpha helix is predicted in the middle of the La molecule and this region contains an immunodominant epitope. Human Ro protein is encoded by a 1.7 kb mRNA and is 60.6 kDa (538 amino acids) in size. A variety of cDNA clones was isolated and characterized, including those from liver, endothelium, brain and placenta. Long regions of predicted alpha helix also reside in the Ro protein but no sequence similarities of La protein have been found. A possible zinc finger motif that is characteristic of other known nucleic acid binding proteins residues near the middle of the Ro protein. Both the La and Ro proteins contain an extended RNA recognition motif about a region of 80 amino acids but they are less similar in this respect than the known snRNA-binding proteins [1].

Authors
Keene, JD
MLA Citation
Keene, JD. "Molecular structure of the La and Ro autoantigens and their use in autoimmune diagnostics." J Autoimmun 2.4 (August 1989): 329-334. (Review)
PMID
2476999
Source
pubmed
Published In
Journal of Autoimmunity
Volume
2
Issue
4
Publish Date
1989
Start Page
329
End Page
334

The U1 RNA-binding site of the U1 small nuclear ribonucleoprotein (snRNP)-associated A protein suggests a similarity with U2 snRNPs.

The site of interaction between human U1 RNA and one of its uniquely associated proteins, A, was examined with in vitro binding assays. The A protein bound directly to stem-loop II of U1 RNA in a region which exhibits sequence similarity to U2 RNA. The similarity with U2 RNA was in a region that has been shown to interact with a U2 RNA-associated protein. The A protein-binding site on U1 RNA overlapped a previously described epitope for an RNA-specific human autoantibody (S. L. Deutscher and J. D. Keene, Proc. Natl. Acad. Sci. USA 85:3299-3303, 1988), supporting the hypothesis that the anti-RNA antibody originated as an anti-idiotypic response to A protein-specific autoantibodies.

Authors
Lutz-Freyermuth, C; Keene, JD
MLA Citation
Lutz-Freyermuth, C, and Keene, JD. "The U1 RNA-binding site of the U1 small nuclear ribonucleoprotein (snRNP)-associated A protein suggests a similarity with U2 snRNPs." Mol Cell Biol 9.7 (July 1989): 2975-2982.
PMID
2528681
Source
pubmed
Published In
Molecular and Cellular Biology
Volume
9
Issue
7
Publish Date
1989
Start Page
2975
End Page
2982

A common RNA recognition motif identified within a defined U1 RNA binding domain of the 70K U1 snRNP protein.

We have defined the RNA binding domain of the 70K protein component of the U1 small nuclear ribonucleoprotein to a region of 111 amino acids. This domain encompasses an octamer sequence that has been observed in other proteins associated with RNA, but has not previously been shown to bind directly to a specific RNA sequence. Within the U1 RNA binding domain, an 80 amino acid consensus sequence that is conserved in many presumed RNA binding proteins was discerned. This sequence pattern appears to represent an RNA recognition motif (RRM) characteristic of a distinct family of proteins. By site-directed mutagenesis, we determined that the 70K protein consists of 437 amino acids (52 kd), and found that its aberrant electrophoretic migration is due to a carboxy-terminal charged domain structurally similar to two Drosophila proteins (su(wa) and tra) that may regulate alternative pre-messenger RNA splicing.

Authors
Query, CC; Bentley, RC; Keene, JD
MLA Citation
Query, CC, Bentley, RC, and Keene, JD. "A common RNA recognition motif identified within a defined U1 RNA binding domain of the 70K U1 snRNP protein." Cell 57.1 (April 7, 1989): 89-101.
PMID
2467746
Source
pubmed
Published In
Cell
Volume
57
Issue
1
Publish Date
1989
Start Page
89
End Page
101

Analysis of autoantibody binding to different regions of the human La antigen expressed in recombinant fusion proteins.

To determine the specificity of autoantibodies for various antigenic sites on a self-protein molecule, sera from 19 patients with anti-La antibodies were tested for their reactivity with molecularly cloned La protein fragments. By quantitative ELISA, anti-La sera from patients with various connective tissue diseases were shown to react with La fusion proteins containing different regions of the La molecule. Two recombinant La fragments containing the carboxyl three-fourths and the middle one-third of the La sequence, respectively, bound higher levels of anti-La antibodies than the two fragments representing the amino and carboxyl terminals. Purified bovine La protein effectively competed for the binding of human autoantibodies to three of the four recombinant La fusion proteins, suggesting similarity in antigenic presentation between the La epitopes in these fusion proteins and the native La molecule. Immunoadsorption experiments showed that most anti-bovine La protein antibodies were removed from a human serum by affinity chromatography by using the fusion protein containing the carboxyl three-fourths of the La sequence, thus supporting the results obtained by quantitative solid phase ELISA. These studies demonstrate that anti-La autoantibodies recognize three La fragments representing separate nonoverlapping regions of the La sequence and are compatible with a mechanism of autoantibody production based on an immune response to the entire self-protein molecule.

Authors
St Clair, EW; Pisetsky, DS; Reich, CF; Keene, JD
MLA Citation
St Clair, EW, Pisetsky, DS, Reich, CF, and Keene, JD. "Analysis of autoantibody binding to different regions of the human La antigen expressed in recombinant fusion proteins." J Immunol 141.12 (December 15, 1988): 4173-4180.
PMID
2461985
Source
pubmed
Published In
Journal of immunology (Baltimore, Md. : 1950)
Volume
141
Issue
12
Publish Date
1988
Start Page
4173
End Page
4180

Genomic structure and amino acid sequence domains of the human La autoantigen.

La is an autoimmune RNA-binding protein of 47 kDa that plays a role in the transcription of RNA polymerase III. Both genomic and complementary DNAs were isolated that encompass the coding sequence of the human La molecule. The genomic clones encompass 11 exons and a putative G/C-rich promoter upstream of the mRNA start site. The cDNA sequence encodes a protein of 408 amino acids and can be divided into two structural domains based upon amino acid content and protease sensitivity. An unusually long stretch of 130 amino acids, much of which was predicted to form a stable alpha-helix, was found near the middle of the protein between the two domains. A ribonucleoprotein (RNP) consensus sequence was found just NH2-terminal to the long alpha-helix. The RNP consensus sequence is split into two exons by the fifth intron. Expression of three separate fragments of the La protein in Escherichia coli showed that a strongly autoimmune-reactive portion resides in the fragment containing the RNP consensus sequence and most of the long alpha-helical core. Autoantibodies from La patients also reacted with the terminal regions of the protein, but the extent of reactivity varied among patients. Differences in reactivity of autoantibodies to each portion of La protein may reflect an evolution of recognition of different epitopes during the development of the autoimmune response. These findings support an antigen-driven mechanism for autoimmune reactivity.

Authors
Chambers, JC; Kenan, D; Martin, BJ; Keene, JD
MLA Citation
Chambers, JC, Kenan, D, Martin, BJ, and Keene, JD. "Genomic structure and amino acid sequence domains of the human La autoantigen." J Biol Chem 263.34 (December 5, 1988): 18043-18051.
PMID
3192525
Source
pubmed
Published In
The Journal of biological chemistry
Volume
263
Issue
34
Publish Date
1988
Start Page
18043
End Page
18051

Molecular analysis of the 60-kDa human Ro ribonucleoprotein.

Ro, or Sjogren syndrome type A (SS-A), antigen is the most prevalent of the human systemic autoimmune specificities and exists as an inabundant ribonucleoprotein complex (RNP) composed of a 60,649-Da protein, as defined here by cDNA cloning, and the human Y RNAs. The recombinant 60-kDa Ro protein and human Y1 RNA were reconstituted in vitro, and the binding was enhanced by divalent cations. A region of the Ro amino acid sequence revealed a resemblance to the RNP consensus motif found in most RNA-binding proteins. In addition, Ro contained a potential "zinc-binding finger" motif that was distinct from the RNP consensus region and that may participate in the interaction with human Y RNAs or with other proteins. The recombinant Ro fusion protein also proved useful for the detection of autoantibodies in the sera of patients with autoimmune disorders. Possible functions of the Ro RNPs and their relationship to RNA polymerase III transcription are discussed.

Authors
Deutscher, SL; Harley, JB; Keene, JD
MLA Citation
Deutscher, SL, Harley, JB, and Keene, JD. "Molecular analysis of the 60-kDa human Ro ribonucleoprotein." Proc Natl Acad Sci U S A 85.24 (December 1988): 9479-9483.
PMID
3200833
Source
pubmed
Published In
Proceedings of the National Academy of Sciences of USA
Volume
85
Issue
24
Publish Date
1988
Start Page
9479
End Page
9483

A sequence-specific conformational epitope on U1 RNA is recognized by a unique autoantibody.

An autoantibody from a patient with lupus-overlap syndrome was found to bind a specific region of U1 RNA. By using RNA sequence analysis, immunoprecipitation, and competition experiments with in vitro synthesized fragments of U1 RNA, a region of 40 nucleotides representing a stem-loop secondary structure was found to be an immunoreactive domain. This antibody recognized a conformational epitope because neither the RNA stem nor the RNA loop alone was immunoprecipitable. Antisense U1 RNA, U1 DNA, and other small RNAs were not reactive with the antibody. While the origins of nucleic acid-binding antibodies are unknown, this RNA-specific autoantibody probably originated by direct presentation to the immune system or as an anti-idiotype against a more common U1 small nuclear ribonucleoprotein-specific autoantibody. Thus, these findings have implications for the mechanisms of autoimmune recognition and provide an immunological approach to probing RNA structure and protein-RNA interactions.

Authors
Deutscher, SL; Keene, JD
MLA Citation
Deutscher, SL, and Keene, JD. "A sequence-specific conformational epitope on U1 RNA is recognized by a unique autoantibody." Proc Natl Acad Sci U S A 85.10 (May 1988): 3299-3303.
PMID
2453054
Source
pubmed
Published In
Proceedings of the National Academy of Sciences of USA
Volume
85
Issue
10
Publish Date
1988
Start Page
3299
End Page
3303

Quantitative immunoassay of anti-La antibodies using purified recombinant La antigen.

A purified recombinant La fusion protein was tested in an enzyme-linked immunosorbent assay to quantitate anti-La responses. This protein contained the immunodominant region of the La molecule fused to beta-galactosidase. In solid-phase assays, recombinant La protein was solubilized in urea and bound to polystyrene wells without loss of immunoreactivity. The recombinant-based enzyme-linked immunosorbent assay proved to be a sensitive method for the detection of anti-La binding, and it accurately distinguished anti-La precipitin positive sera from normal sera.

Authors
St Clair, EW; Pisetsky, DS; Reich, CF; Chambers, JC; Keene, JD
MLA Citation
St Clair, EW, Pisetsky, DS, Reich, CF, Chambers, JC, and Keene, JD. "Quantitative immunoassay of anti-La antibodies using purified recombinant La antigen." Arthritis Rheum 31.4 (April 1988): 506-514.
PMID
3128988
Source
pubmed
Published In
Arthritis and Rheumatism
Volume
31
Issue
4
Publish Date
1988
Start Page
506
End Page
514

A human autoimmune protein associated with U1 RNA contains a region of homology that is cross-reactive with retroviral p30gag antigen.

cDNA encoding a 70 kd protein (70K) associated with U1 small nuclear ribonucleoprotein (snRNP) was cloned from a human brain-stem library using autoantibodies from patients with connective tissue disease. The cDNA-derived amino acid sequence contains 23 residues homologous to a region of murine leukemia virus group-specific antigen p30gag. The homology residues in an antigenic portion of the 70K protein and is defined by a core consensus sequence, ETPEEREERRR, that occurs as a tandem repeat in p30gag of most mammalian type C retroviruses. Anti-p30gag antibodies recognized a recombinant 70K-LacZ fusion protein as well as U1 snRNPs. Using synthetic peptides as competitors, we demonstrated that the region of homology encompasses the site of immunological cross-reactivity. Thus autoantibodies against U1 snRNPs were elicited by immunization with p30gag. On the basis of these findings, we suggest a role for retroviruses in the initiation of autoimmunity.

Authors
Query, CC; Keene, JD
MLA Citation
Query, CC, and Keene, JD. "A human autoimmune protein associated with U1 RNA contains a region of homology that is cross-reactive with retroviral p30gag antigen." Cell 51.2 (October 23, 1987): 211-220.
PMID
2959371
Source
pubmed
Published In
Cell
Volume
51
Issue
2
Publish Date
1987
Start Page
211
End Page
220

Molecular characterization of the Ro small cytoplasmic RNPS

Authors
Deutscher, SL; Harley, JB; Keene, JD
MLA Citation
Deutscher, SL, Harley, JB, and Keene, JD. "Molecular characterization of the Ro small cytoplasmic RNPS." Molecular Biology Reports 12.3 (1987): 242--.
Source
scival
Published In
Molecular Biology Reports
Volume
12
Issue
3
Publish Date
1987
Start Page
242-
DOI
10.1007/BF00356920

Molecular analysis of the U2 snRNP unique protein A′

Authors
Fresco, LD; Keene, JD
MLA Citation
Fresco, LD, and Keene, JD. "Molecular analysis of the U2 snRNP unique protein A′." Molecular Biology Reports 12.3 (1987): 155--.
Source
scival
Published In
Molecular Biology Reports
Volume
12
Issue
3
Publish Date
1987
Start Page
155-
DOI
10.1007/BF00356873

The U1 RNA-specific 70K protein: RNA-binding studies and autoimmune cross-reactivity with type-C retroviruses

Authors
Query, CC; Keene, JD
MLA Citation
Query, CC, and Keene, JD. "The U1 RNA-specific 70K protein: RNA-binding studies and autoimmune cross-reactivity with type-C retroviruses." Molecular Biology Reports 12.3 (1987): 158--.
Source
scival
Published In
Molecular Biology Reports
Volume
12
Issue
3
Publish Date
1987
Start Page
158-
DOI
10.1007/BF00356875

Nature of the la and ro RNPs

Authors
Keene, JD; Deutscher, SL; Kenan, D; Kelekar, A
MLA Citation
Keene, JD, Deutscher, SL, Kenan, D, and Kelekar, A. "Nature of the la and ro RNPs." Molecular Biology Reports 12.3 (1987): 235-238.
Source
scival
Published In
Molecular Biology Reports
Volume
12
Issue
3
Publish Date
1987
Start Page
235
End Page
238
DOI
10.1007/BF00356917

Association between autoimmune epitopes and RNA binding domains of the human Lupus La protein

Authors
Chambers, JC; Keene, JD
MLA Citation
Chambers, JC, and Keene, JD. "Association between autoimmune epitopes and RNA binding domains of the human Lupus La protein." Molecular Biology Reports 12.3 (1987): 241--.
Source
scival
Published In
Molecular Biology Reports
Volume
12
Issue
3
Publish Date
1987
Start Page
241-
DOI
10.1007/BF00356919

Rapid inhibition of processing and assembly of small nuclear ribonucleoproteins after infection with vesicular stomatitis virus

Authors
Fresco, LD; Kurilla, MG; Keene, JD
MLA Citation
Fresco, LD, Kurilla, MG, and Keene, JD. "Rapid inhibition of processing and assembly of small nuclear ribonucleoproteins after infection with vesicular stomatitis virus." Molecular and Cellular Biology 7.3 (1987): 1148-1155.
PMID
3031484
Source
scival
Published In
Molecular and Cellular Biology
Volume
7
Issue
3
Publish Date
1987
Start Page
1148
End Page
1155

Autoantibodies specific for U1 RNA and initiator methionine tRNA

Autoantibodies reactive with specific nuclear and cytoplasmic small RNAs were identified by immunoprecipitation of HeLa cell RNA. Approximately 30% of antisera examined from patients with autoimmune disorders contained anti-RNA antibodies. Two previously undescribed specificities - anti-U1 RNA and anti-initiator methionine tRNA - were identified. Anti-RNA antibodies were reactive with gel-purified species as well as with RNA synthesized in vitro using the SP-6 transcription system. Antigenic mapping using two sera specific for the human initiator methionine tRNA revealed separate epitopes, one of which is conserved in formyl-methionine initiator tRNA from Escherichia coli. RNA fragmentation studies further suggested that secondary or tertiary tRNA structure is required for antibody recognition. The mammalian U1 RNA specific antibodies did not precipitate small RNAs of yeast but were highly reactive with yeast ribosomal RNA, thus indicating a possible relationship between these RNA species. Results obtained with these antisera are discussed in terms of higher order structure of small RNA molecules as well as the role of nucleic acid antibodies in the autoimmune phenomenon.

Authors
Wilusz, J; Keene, JD
MLA Citation
Wilusz, J, and Keene, JD. "Autoantibodies specific for U1 RNA and initiator methionine tRNA." Journal of Biological Chemistry 261.12 (1986): 5467-5472.
PMID
2420801
Source
scival
Published In
Journal of Biological Chemistry
Volume
261
Issue
12
Publish Date
1986
Start Page
5467
End Page
5472

Conservation of the 3′ terminal nucleotide sequences of Ebola and Marburg virus

The 3′ RNA base sequences of several Marburg (MBG) and Ebola (EBO) virus isolates have been determined. A comparison of these 3′ terminal noncoding sequences with those of other negative strand RNA viruses suggests a unique phylogenic niche for Marburg and Ebola viruses. The translation initiation site and 35 N-terminal amino acids of the 3′ proximal coding gene of a Zaire strain of Ebola virus was predicted. In addition, putative leader RNA sequences preceding the first gene are discussed in terms of possible regulatory functions. © 1986.

Authors
Kiley, MP; Wilusz, J; Cormick, JBM; Keene, JD
MLA Citation
Kiley, MP, Wilusz, J, Cormick, JBM, and Keene, JD. "Conservation of the 3′ terminal nucleotide sequences of Ebola and Marburg virus." Virology 149.2 (1986): 251-254.
PMID
3946083
Source
scival
Published In
Virology
Volume
149
Issue
2
Publish Date
1986
Start Page
251
End Page
254

Specificity and idiotypic analysis of a monoclonal anti-Sm antibody with anti-DNA activity.

To investigate the mechanisms of anti-Sm expression in murine systemic lupus erythematosus (SLE), the idiotypic determinants of a monoclonal anti-Sm antibody were studied. This antibody, 2G7, was derived from the fusion of spleen cells of an autoimmune MRL-lpr/lpr mouse with the 653 myeloma. Specificity for Sm was demonstrated by an ELISA with the use of affinity-purified Sm as well as immunoprecipitation of radiolabeled RNA. An anti-2G7 antiserum was prepared in a rabbit and rendered specific for idiotype by extensive absorption against BALB/c and MRL-lpr/lpr monoclonal proteins. The resulting antiserum detected determinants found on 2G7 as well as on two MRL anti-DNA antibodies, 6/P and 6/N, an independently derived MRL-lpr/lpr anti-Sm called 7.13, and the BALB/c myeloma FLOPC 21. Two distinct determinants could be demonstrated by the creation of cross-reactive idiotype systems by using the various monoclonal antibodies as ligands for the anti-idiotype. Both idiotypes were demonstrated in sera of normal and autoimmune mice, although MRL +/-/+/- mice had the highest levels of strains tested. To explain the pattern of idiotypic relatedness, 2G7 was tested for anti-DNA activity by ELISA. 2G7 displayed activity for single-stranded DNA as well as synthetic DNA and RNA homopolymers. Absorption analysis indicated that the anti-DNA and anti-Sm binding activities were the product of the same antibody. These results suggest that anti-Sm and anti-DNA may be related by both idiotype and antigenic specificity, providing a mechanism for their common expression in SLE.

Authors
Pisetsky, DS; Hoch, SO; Klatt, CL; O'Donnell, MA; Keene, JD
MLA Citation
Pisetsky, DS, Hoch, SO, Klatt, CL, O'Donnell, MA, and Keene, JD. "Specificity and idiotypic analysis of a monoclonal anti-Sm antibody with anti-DNA activity." J Immunol 135.6 (December 1985): 4080-4085.
PMID
3877763
Source
pubmed
Published In
Journal of immunology (Baltimore, Md. : 1950)
Volume
135
Issue
6
Publish Date
1985
Start Page
4080
End Page
4085

Interactions between small viral RNAs of vesicular stomatitis virus and components of cellular gene expression.

Recent interest in the details of virus-host interactions has come to focus on molecular contacts between cell factors and components of viruses. These generally concern protein-protein and protein-nucleic acid interactions. In this review, protein-nucleic acid interactions involving viral transcription products and cell proteins are considered. Also examined here will be the hypothesis that such interactions have evolved because viruses have adopted cellular processes to favour their own replication and that the consequences of this co-evolution can be the disruption of the macromolecular functions of the cell, and eventual cytopathology. For its own survival in the long term, the host may evolve more refined mechanisms to evade the damage levied by the intruding virus.

Authors
Keene, JD
MLA Citation
Keene, JD. "Interactions between small viral RNAs of vesicular stomatitis virus and components of cellular gene expression." Microbiol Sci 2.5 (May 1985): 152-156. (Review)
PMID
2856377
Source
pubmed
Published In
Microbiological Sciences
Volume
2
Issue
5
Publish Date
1985
Start Page
152
End Page
156

RNA sequence and transcriptional properties of the 3′ end of the Newcastle disease virus genome

The 3′ end of the genomic RNA of Newcastle disease virus (NDV) has been sequenced and the leader RNA defined. Using hybridization to a 3′-end-labeled genome, leader RNA species from in vitro transcription reactions and from infected cell extracts were found to be 47 and 53 nucleotides long. In addition, the start site of the 3′-proximal mRNA was determined by sequence analysis of in vitro [β-32P]GTP-labeled transcription products. The genomic sequence extending beyond the leader region demonstrated an open reading frame for at least 42 amino acids and probably represents the amino terminus of the nucleocapsid protein (NP). The terminal 8 nucleotides of the NDV genome were identical to those of measles virus and Sendai virus while the sequence of the distal half of the leader region was more similar to that of vesicular stomatitis virus. These data argue for strong evolutionary relatedness between the paramyxovirus and rhabdovirus groups. © 1985.

Authors
Kurilla, MG; Stone, HO; Keene, JD
MLA Citation
Kurilla, MG, Stone, HO, and Keene, JD. "RNA sequence and transcriptional properties of the 3′ end of the Newcastle disease virus genome." Virology 145.2 (1985): 203-212.
PMID
4024452
Source
scival
Published In
Virology
Volume
145
Issue
2
Publish Date
1985
Start Page
203
End Page
212

Replication of the vesicular stomatitis virus genome in permissive and nonpermissive host cells

Permissive infections of BHK cells and nonpermissive infections of Raji cells were probed for the accumulation of vesicular stomatitis virus intracellular RNAs. In Raji cells, the onset of vesicular stomatitis virus transcription and replication was delayed when compared to BHK cells, and the accumulation of plus and minus sense leader RNAs was significantly reduced. In contrast, full length plus and minus strand replicative RNAs accumulated in Raji cells to levels approximately equivalent to those in BHK cells. In both cell types, approximately four times as many minus strands as plus strands were detected late in the infections. At 16 h postinfection, 12% of the total genomic RNA synthesized in BHK cells was packaged and released whereas only 0.8% was released from Raji cells. In addition, of those particles released by Raji cells, only 1% were infectious whereas 77% of those released by BHK cells were infectious. The virions released from both cell types contained similar amounts of the five viral proteins, however. Analysis of virions from Raji cells revealed a faster electrophoretic mobility of the glycoprotein than the glycoprotein in virions released from BHK cells. These results suggest that Raji cells may be restricted in their ability to support a complete infection at the level of virus assembly rather than at the level of RNA replication.

Authors
Piwnica-Worms, H; Keene, JD
MLA Citation
Piwnica-Worms, H, and Keene, JD. "Replication of the vesicular stomatitis virus genome in permissive and nonpermissive host cells." Journal of Biological Chemistry 260.19 (1985): 10503-10511.
Source
scival
Published In
Journal of Biological Chemistry
Volume
260
Issue
19
Publish Date
1985
Start Page
10503
End Page
10511

Alu RNA-protein complexes formed in vitro react with a novel lupus autoantibody

We have screened sera from patients with systemic lupus erythematosus for reactivity with RNA transcribed in vitro using HeLa whole cell extracts. Sera from 14 out of 114 patients precipitated an RNA transcribed by RNA polymerase III from a plasmid containing an Alu family sequence (i.e. the repetitive DNA sequence that is cut by the Alu restriction enzyme) located upstream from the human γ(G)-globin gene. These Alu transcripts were not precipitated by anti-La, anti-Sm, anti-RNP or anti-Ro antibodies, suggesting that Alu RNA was precipitated by a previously undescribed lupus specificity. Analysis of [35S]methionine-labeled immunoprecipitates indicated that Alu RNA binds a protein of about 68 kDa. This protein may be Alu specific since three different Alu transcripts were precipitated by the anti-Alu sera whereas another RNA polymerase III transcript, adenovirus VA I RNA, was not precipitated by the same sera.

Authors
Kole, R; Fresco, LD; Keene, JD; Cohen, PL; Eisenberg, RA; Andrews, PG
MLA Citation
Kole, R, Fresco, LD, Keene, JD, Cohen, PL, Eisenberg, RA, and Andrews, PG. "Alu RNA-protein complexes formed in vitro react with a novel lupus autoantibody." Journal of Biological Chemistry 260.21 (1985): 11781-11786.
Source
scival
Published In
The Journal of biological chemistry
Volume
260
Issue
21
Publish Date
1985
Start Page
11781
End Page
11786

Base mutations in the terminal noncoding regions of the genome of vesicular stomatitis virus isolated from persistent infections of L cells

The 3′-terminal regions of the genomes of vesicular stomatitis virus obtained from two long-term, independently initiated persistent infections of L cells were found to contain several sequence mutations. In contrast to the hypermutability displayed in the 5′-terminal regions of the genomes of viruses obtained from persistent infections of baby hamster kidney (BHK) cells (P. J. O'Hara, F. M. Horodyski, S. T. Nichol, and J. J. Holland, J. Virol. 49, 793-798, 1984), no 5′ mutations were detected in viruses from L-cell carrier lines. The absence of detectable defective interfering (DI) particles in the L-cell carrier cultures may account for this difference. Plus-strand leader RNA made by the viruses from persistently infected L cells failed to accumulate from 5 to 8 hr postinfection unlike the accumulation noted for the leader RNA generated by wild-type VSV. Minus-strand leader RNA, on the other hand, accumulated at a similar or increased rate compared to wild type. The relationship of these observations to the processes of host shutoff, viral transcription, and replication are discussed. © 1985.

Authors
Wilusz, J; Youngner, JS; Keene, JD
MLA Citation
Wilusz, J, Youngner, JS, and Keene, JD. "Base mutations in the terminal noncoding regions of the genome of vesicular stomatitis virus isolated from persistent infections of L cells." Virology 140.2 (1985): 249-256.
PMID
2982234
Source
scival
Published In
Virology
Volume
140
Issue
2
Publish Date
1985
Start Page
249
End Page
256

Isolation and analysis of cDNA clones expressing human lupus La antigen

Several cDNA clones of the La antigen recognized by certain lupus autoantibodies were isolated from λgt11 expression libraries made from human liver. Recombinant clones were used to hybrid-select HeLa cell mRNA that was subsequently translated in vitro into a single protein species that comigrated with HeLa cell La protein. The in vitro translated protein was reactive with anti-La patient sera and was identical to the authentic La protein by peptide mapping. By analyzing overlapping cDNA clones, we mapped an antigenic site of La protein at the terminal 12% of the carboxyl end of the molecule. Within this region we identified a unique decapeptide of high hydrophilicity that may consitute a La antigenic determinant. We further demonstrated that the La antigen expressed from the recombinant clones can be used in a definitive enzyme-linked assay (ELISA) for the classification of sera from patients with systemic lupus erythematosus.

Authors
Chambers, JC; Keene, JD
MLA Citation
Chambers, JC, and Keene, JD. "Isolation and analysis of cDNA clones expressing human lupus La antigen." Proceedings of the National Academy of Sciences of the United States of America 82.7 (1985): 2115-2119.
PMID
3856888
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
82
Issue
7
Publish Date
1985
Start Page
2115
End Page
2119

Sites of copy choice replication involved in generation of vesicular stomatitis virus defective-interfering particle RNAs

The copy choice model for the generation of defective interfering (DI) particles of vesicular stomatitis virus suggests that during replication the polymerase prematurely terminates, moves with the nascent daughter strand to another site on the same or a different template molecule, and resumes elongation of the nascent chain. We have analyzed the sites where premature termination or resumption of replication has occurred during the generation of the deletion DI particle LT, the snapback DI particle 011, and the panhandle DI particles T, T(L), and 611. The recombination sites were identified by comparing the nucleotide sequences of the relevant regions of these DI particle RNAs to those of the vesicular stomatitis virus L gene (Schubert et al., J. Virol. 51:505-514, 1984). Sequence homology was not detected between these sites, which rules out the existence of a general terminator or promoter sequence involved in copy choice replication. In several cases, however, premature termination or resumption of RNA replication may be favored by specific signal sequences. The sequences immediately before the start and at the end of the deletion in DI LT contain two hexanucleotides, ATCTGA and GATTGG, in a similar spacing. In the case of DI T and 611, but not of DI T (L), the end of the 5'-terminal region bears the hexanucleotide CCUCUU. This sequence is also repeated in the stem region in all three DI particle genomes. In addition, we present data that the added 3'-terminal regions of the panhandle DI particle RNAs may differ by only one base and are 46 [DI T(L) and 611] or 45 (DI T) bases long. We suggest that each site of the vesicular stomatitis virus genome has the potential to give rise to DI particle RNAs. Specific sequences, however, may modulate this process in a quantitative way, and they favor the generation of certain types of DI particle genomes like those of the panhandle type.

Authors
Meier, E; Harmison, GG; Keene, JD; Schubert, M
MLA Citation
Meier, E, Harmison, GG, Keene, JD, and Schubert, M. "Sites of copy choice replication involved in generation of vesicular stomatitis virus defective-interfering particle RNAs." Journal of Virology 51.2 (1984): 515-521.
PMID
6086960
Source
scival
Published In
Journal of Virology
Volume
51
Issue
2
Publish Date
1984
Start Page
515
End Page
521

Interactions of plus and minus strand leader RNAs of the New Jersey serotype of vesicular stomatitis virus with the cellular La protein

The New Jersey serotype of vesicular stomatitis virus (VSV-NJ) was found to synthesize a minus strand leader RNA of 44-46 bases long and a plus strand leader RNA of 47-50 bases long in infected cells. The minus strand leader RNA of VSV-NJ was found associated with the host cell La protein in infected cells by immunoprecipitation with antisera from patients with systemic lupus erythematosus. These results differ from those reported previously (J. Wilusz, M. G. Kurilla, and J. D. Keene (1983). Proc. Natl. Acad. Sci USA 80, 5827-5831) for the similarly sized species of minus strand leader RNA made by the Indiana serotype of VSV (VSV-IND). Despite sequence differences between the 3′ ends of the plus strand leader RNAs of the two serotypes, the plus strand leader RNA of VSV-NJ was found to have a pattern of La protein accumulation similar to that reported previously for the plus strand leader RNA of VSV-IND. These results provide additional support for a role for La protein in VSV replication and help further delineate the sequence requirements for La protein binding to VSV leader RNAs. © 1984.

Authors
Wilusz, J; Keene, JD
MLA Citation
Wilusz, J, and Keene, JD. "Interactions of plus and minus strand leader RNAs of the New Jersey serotype of vesicular stomatitis virus with the cellular La protein." Virology 135.1 (1984): 65-73.
PMID
6203219
Source
scival
Published In
Virology
Volume
135
Issue
1
Publish Date
1984
Start Page
65
End Page
73

Nucleotide sequence and host La protein interactions of rabies virus leader RNA

Rabies virus leader RNA was detected in infected BHK-21 cell extracts by hybridization to end-labeled genomic RNA. Similar to the leader RNA of vesicular stomatitis virus, the leader RNA of rabies virus was also found to be associated with the La protein by specific immunoprecipitation with antisera from lupus patients. The 3' end of the genomic RNA of rabies virus was sequenced, and the size and termination site of leader RNA were determined. In addition, extension of the sequence into the nucleocapsid gene of rabies virus showed an open reading frame for at least 37 amino acid residues. Sequence relationships between rabies virus and vesicular stomatitis virus leader genes and the possible involvement of the La protein in rhabdovirus biology are discussed.

Authors
Kurilla, MG; Cabradilla, CD; Holloway, BP; Keene, JD
MLA Citation
Kurilla, MG, Cabradilla, CD, Holloway, BP, and Keene, JD. "Nucleotide sequence and host La protein interactions of rabies virus leader RNA." Journal of Virology 50.3 (1984): 773-778.
PMID
6328006
Source
scival
Published In
Journal of Virology
Volume
50
Issue
3
Publish Date
1984
Start Page
773
End Page
778

Sequential synthesis of small capped RNA transcripts in Vitro by vesicular stomatitis virus

Using purified viral or intracellular transcriptive complexes (RNP cores) of vesicular stomatitis virus (VSV), we have identified several small RNA species, ranging in size from 12 to 47 nucleotides in length that are synthesized in vitro by the genomic RNA. One group of small RNA transcripts is composed of three species that are capped at their 5′ termini. Two of the capped species are from the start of the N gene and one is from the start of the NS gene. Unlike the previously described 5′ triphosphated small RNAs, the templates encoding these small capped RNAs had uv target sizes greater than their respective lengths. In addition, these RNAs appeared sequentially during synchronized in vitro transcription reactions. Thus, these results provide evidence that sequences representing the 5′-capped termini of N and NS mRNAs are synthesized concomitantly with their respective mRNAs rather than simultaneously at the onset of transcription as proposed for the multiple entry, start-stop model (D. Testa, P. K. Chanda, and A. K. Banerjee, 1980, Cell21, pp. 267-275). Together with the inability of the internally initiated 5′-triphosphated RNAs to be chased into mRNA (R. A. Lazzarini, I. Chien, F. Yang, and J. D. Keene, 1982, J. Gen. Virol.58, 429-441), these results support a single entry model of VSV mRNA transcription. © 1983.

Authors
Piwnica-Worms, H; Keene, JD
MLA Citation
Piwnica-Worms, H, and Keene, JD. "Sequential synthesis of small capped RNA transcripts in Vitro by vesicular stomatitis virus." Virology 125.1 (1983): 206-218.
PMID
6299007
Source
scival
Published In
Virology
Volume
125
Issue
1
Publish Date
1983
Start Page
206
End Page
218

The leader RNA of vesicular stomatitis virus is bound by a cellular protein reactive with anti-La lupus antibodies

The leader RNA transcript of vesicular stomatitis virus (VSV) has been immunoprecipitated from infected BHK cell extracts by anti-La specific sera from patients with systemic lupus erythematosus (SLE). This association was specific as lupus antisera with other specificities failed to precipitate leader RNA. The amount of leader RNA associated with the La antigen peaked 4 hr post infection and then declined. Leader RNA complexed with viral nucleocapsid proteins increased at a slower rate but eventually predominated 6 hr post infection. By 16 hr all of the leader RNA was associated with nucleo-capsid proteins. Although a significant portion of the leader RNA was present in isolated nuclei 4 hr post infection, all of the leader RNA outside the nucleus was bound to La protein. Leader RNA is the first non-RNA polymerase III product found to associate with the La protein. The proposed function of the leader-La complex in VSV transcription and replication and in viral cytopathology is discussed. © 1983.

Authors
Kurilla, MG; Keene, JD
MLA Citation
Kurilla, MG, and Keene, JD. "The leader RNA of vesicular stomatitis virus is bound by a cellular protein reactive with anti-La lupus antibodies." Cell 34.3 (1983): 837-845.
PMID
6313210
Source
scival
Published In
Cell
Volume
34
Issue
3
Publish Date
1983
Start Page
837
End Page
845

Association between the 7 S RNA and the lupus La protein varies among cell types

The La antigen recognized by certain lupus erythematosus autoantibodies was found to be predominantly associated with 7 S RNA in baby hamster kidney cells and human Raji cells, but not in HeLa cells where mainly the 7-2 RNA was associated with the La protein. In mouse myeloma cells (MPC-11) and mouse lymphoma cells (WEHI) that secrete immunoglobulins, equal amounts of 7 S and 7-2 RNAs were present in anti-La immunoprecipitates. The highly conserved 7 S RNA is a component of the signal recognition particle involved in protein secretion, and its association with the La antigen appeared to be cell-type specific. Thus, it is possible that the La-7 S RNA association correlates with the abundance of 7 S RNA or with the secretory activity of the cell type.

Authors
Chambers, JC; Kurilla, MG; Keene, JD
MLA Citation
Chambers, JC, Kurilla, MG, and Keene, JD. "Association between the 7 S RNA and the lupus La protein varies among cell types." Journal of Biological Chemistry 258.19 (1983): 11438-11441.
Source
scival
Published In
Journal of Biological Chemistry
Volume
258
Issue
19
Publish Date
1983
Start Page
11438
End Page
11441

A host protein (La) binds to a unique species of minus-sense leader RNA during replication of vesicular stomatitis virus

Baby hamster kidney cells infected with the minus-strand RNA virus vesicular stomatitis virus (VSV) were found to contain three small viral leader RNA species of the minus sense. The longest minus-strand leader RNA was 54 nucleotides long and was complexed with the host cell La protein that was immunoprecipitated by antisera from patients with systemic lupus erythematosus. The La protein is normally found associated with RNA polymerase III transcripts in their unprocessed form. Shorter minus-strand leader RNA species of 45-48 nucleotides were more abundant but were not associated with the La protein. Unlike the plus-strand leader RNA of VSV, the minus-strand leader RNAs were not detected in the nucleus in any form. The minus-strand leader RNAs accumulated gradually throughout the infection and could not be found in association with the viral nucleocapsid protein. The sequence required for La protein binding on the 54-nucleotide-long minus-strand leader is similar to that at the 3' end of the La protein binding-plus-strand leader RNA and, thus, we propose a role for the La protein in the replication of VSV.

Authors
Wilusz, J; Kurilla, MG; Keene, JD
MLA Citation
Wilusz, J, Kurilla, MG, and Keene, JD. "A host protein (La) binds to a unique species of minus-sense leader RNA during replication of vesicular stomatitis virus." Proceedings of the National Academy of Sciences of the United States of America 80.19 I (1983): 5827-5831.
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
80
Issue
19 I
Publish Date
1983
Start Page
5827
End Page
5831

The sequence at the termini of four genes of the three reovirus serotypes.

Authors
Gaillard, RK; Li, JK; Keene, JD; Joklik, WK
MLA Citation
Gaillard, RK, Li, JK, Keene, JD, and Joklik, WK. "The sequence at the termini of four genes of the three reovirus serotypes." Virology 121.2 (September 1982): 320-326.
PMID
7123853
Source
pubmed
Published In
Virology
Volume
121
Issue
2
Publish Date
1982
Start Page
320
End Page
326

Rapid and transient localization of the leader RNA of vesicular stomatitis virus in the nuclei of infected cells

The leader RNA transcript from the 3' end of the genome of vesicular stomatitis virus (VSV) has been detected in both the nucleus and cytoplasm of infected baby hamster kidney (BHK) cells. In the cytoplasm, leader RNA accumulated gradually throughout the infection to about 200 molecules per cell at 6 hr after infection. In the nucleus, however, there was a sharp and rapid increase in the concentration of leader RNA to ≃300 molecules per cell at about 2 hr after infection that decreased rapidly by 3 hr. This report presents evidence for nuclear localization of transcription products of a (-)-strand RNA virus other than influenza and supports the hypothesis that the leader RNA plays a role in the shutoff of host cell transcription.

Authors
Kurilla, MG; Piwnica-Worms, H; Keene, JD
MLA Citation
Kurilla, MG, Piwnica-Worms, H, and Keene, JD. "Rapid and transient localization of the leader RNA of vesicular stomatitis virus in the nuclei of infected cells." Proceedings of the National Academy of Sciences of the United States of America 79.17 I (1982): 5240-5244.
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
79
Issue
17 I
Publish Date
1982
Start Page
5240
End Page
5244

The metabolic fate of independently initiated VSV mRNA transcripts

The kinetics of synthesis and the metabolic stability of uncapped vesicular stomatitis virus (VSV) mRNA transcripts have been studied using techniques which clearly differentiate them from other RNA species. The triphosphate-initiating mRNA transcripts accumulate for at least 5 h during a typical in vitro transcription reaction. The great majority of these transcripts are smaller than a functional message and have been released from the template-transcriptase complex. Label that accumulates in them is stable and is not detectably diminished after a 1 h chase with unlabelled precursor. These kinetic properties are not those expected for active intermediates in mRNA synthesis and suggest that the uncapped transcripts are products of aborted transcription that accumulate during the transcriptive process. However, we cannot rule out that a small subset of these transcripts may be elongated into mature mRNA. Initiation of transcription at internal positions along the VSV genome is both frequent (one-half to one-sixth as frequent as initiations at the leader RNA gene) and site-specific (occurring only at the beginning of cistrons). The relevance of these results to the models for VSV transcription is discussed.

Authors
Lazzarini, RA; Chien, I; Yang, F; Keene, JD
MLA Citation
Lazzarini, RA, Chien, I, Yang, F, and Keene, JD. "The metabolic fate of independently initiated VSV mRNA transcripts." Journal of General Virology 58.2 (1982): 429-441.
Source
scival
Published In
Journal of General Virology
Volume
58
Issue
2
Publish Date
1982
Start Page
429
End Page
441

Association of 3′ terminal RNA sequences with avian leukosis viruses causing a high incidence of osteopetrosis

The T1 ribonuclease fingerprints of the genomic RNAs of four osteopetrosis-inducing, avian leukosis viruses were compared with fingerprints of the RNAs from four unrelated avian retroviruses. Two oligonucleotides at the 3′ end of the genomes of all osteopetrosis-inducing viruses were not present in the RNAs of the four viruses that did not induce osteopetrosis. This evidence suggests that genetic information related to the induction of a high frequency of osteopetrosis is present at the 3′ end of the genomes of these viruses. © 1982.

Authors
Schmidt, EV; Keene, JD; Linial, M; Smith, RE
MLA Citation
Schmidt, EV, Keene, JD, Linial, M, and Smith, RE. "Association of 3′ terminal RNA sequences with avian leukosis viruses causing a high incidence of osteopetrosis." Virology 116.1 (1982): 163-180.
PMID
6278705
Source
scival
Published In
Virology
Volume
116
Issue
1
Publish Date
1982
Start Page
163
End Page
180

RNA polymerase-associated interactions near template promoter sequences of defective interfering particles of vesicular stomatitis virus

Methylation protection studies suggested that the NS protein component of the RNA polymerase of vesicular stomatitis virus contacts the RNA templates of defective interfering (DI) particles at the sequence 3'...GUCUAUUUUUUAUUUUUGGUG...5', 17 to 37 nucleotides downstream from the site of initiation of in vitro transcription. The data indicated that vesicular stomatitis virus and DI particle RNAs contain different polymerase binding sequences and that NS may function as a transcription initiator protein for template recognition at both sequences. These results are thus compatible with the hypothesis that differences in the rate of defective and nondefective viral particle replication and autointerference are due to higher affinity binding sites for polymerase at the 3' end of DI particle RNAs. In addition, a unique DI particle (DI-LT2) RNA that contains a transcriptionally inactive vesicular stomatitis virus leader gene 72 to 118 nucleotides from its 3' end showed interactions with the viral polymerase similar to those reported previously for the 3'-terminal vesicular stomatitis virus leader gene (Keene et al., Proc. Natl. Acad. Sci. U.S.A. 78:6191-6195, 1981). The interaction of polymerase with the internal leader gene of DI-LT2 RNA suggested that the lack of leader RNA and mRNA production by this particle is not due to the inability of polymerase to bind to internal sites along the template. Instead, the initiation of transcription is more likely influenced by the position of the polymerase binding site relative to the 3' end or by requisite interactions between the catalytic polymerase component (L) and the proposed initiator protein (NS).

Authors
Isaac, CL; Keene, JD
MLA Citation
Isaac, CL, and Keene, JD. "RNA polymerase-associated interactions near template promoter sequences of defective interfering particles of vesicular stomatitis virus." Journal of Virology 43.1 (1982): 241-249.
PMID
6286999
Source
scival
Published In
Journal of Virology
Volume
43
Issue
1
Publish Date
1982
Start Page
241
End Page
249

The origins of defective interfering particles of the negative-strand RNA viruses

Authors
Lazzarini, RA; Keene, JD; Schubert, M
MLA Citation
Lazzarini, RA, Keene, JD, and Schubert, M. "The origins of defective interfering particles of the negative-strand RNA viruses." Cell 26.2 PART 2 (January 1, 1981): 145-154. (Review)
Source
scopus
Published In
Cell
Volume
26
Issue
2 PART 2
Publish Date
1981
Start Page
145
End Page
154
DOI
10.1016/0092-8674(81)90298-1

Transfer RNAs associated with vesicular stomatitis virus

The predominant RNAs in purified VSV particles are 42S and 4S in size. The 4S RNA is host transfer RNA that did not incorporate detectable radiolabel during VSV infection and was detected by in vitro labelling. Surprisingly, when BHK cells were prelabelled for 30 to 54 h before infection, the incorporation of [3H]uridine and [32P]orthophosphate into virus tRNAs remained very low and virus tRNAs were found to have a 5- to 15-fold lower specific activity than the total host tRNA, the value depending, in part, upon the period of prelabelling. Two-dimensional gel electrophoresis and partial sequence analysis indicated that the virus tRNAs include most species of host tRNA and no singly predominant species was apparent. Transfer RNAs are packaged by several enveloped viruses, but we have not found 4S RNA in reovirus, which lacks an envelope. We suggest that VSV contains a membrane-associated population of tRNA which has a slower rate of turnover than the total population of cellular tRNA.

Authors
Isaac, CL; Keene, JD
MLA Citation
Isaac, CL, and Keene, JD. "Transfer RNAs associated with vesicular stomatitis virus." Journal of General Virology 56.1 (1981): 141-151.
Source
scival
Published In
Journal of General Virology
Volume
56
Issue
1
Publish Date
1981
Start Page
141
End Page
151

The origins of defective interfering particles of the negative-strand RNA viruses

Authors
Lazzarini, RA; Keene, JD; Schubert, M
MLA Citation
Lazzarini, RA, Keene, JD, and Schubert, M. "The origins of defective interfering particles of the negative-strand RNA viruses." Cell 26.2 PART 2 (1981): 145-154.
PMID
7037195
Source
scival
Published In
Cell
Volume
26
Issue
2 PART 2
Publish Date
1981
Start Page
145
End Page
154

Sequence-specific contacts between the RNA polymerase of vesicular stomatitis virus and the leader RNA gene

Methylation-protection studies with nucleocapsids from vesicular stomatitis virus indicate that the viral polymerase (L and NS proteins) contacts the genomic RNA template in the middle of the leader gene, 16-30 nucleotides from the 3' terminus. The data suggest that the NS protein binds to the sequence 3'-G-G-U-A-A-U-A-A-U-A-G-U-A-A-U 5' and may function as an initiator protein for transcription.

Authors
Keene, JD; Thornton, BJ; Emerson, SU
MLA Citation
Keene, JD, Thornton, BJ, and Emerson, SU. "Sequence-specific contacts between the RNA polymerase of vesicular stomatitis virus and the leader RNA gene." Proceedings of the National Academy of Sciences of the United States of America 78.10 I (1981): 6191-6195.
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
78
Issue
10 I
Publish Date
1981
Start Page
6191
End Page
6195

Vesicular stomatitis virus defective interfering particle containing a muted internal leader RNA gene

The RNA of a unique long defective interfering particle (DI-LT2) derived from the heat-resistant strain of vesicular stomatitis virus (VSV) contains 70 nucleotides at its 3' end that are complementary to the 5' end of the VSV RNA. Following this region of terminal complementarity, there is a precise copy of the 3' end of the nondefective VSV RNA. The sequence homology between the DI-LT2 RNA and the 3' end of VSV RNA extends for at least 60 bases and probably for most of the length of the DI-LT2 RNA. the DI-LT2 particle is capable of transcription in vitro but produces only a short RNA [defective interfering (DI) particle product], which is encoded by the extreme 3' terminus of the DI RNA. Neither leader RNA nor capped VSV mRNAs are synthesized by DI-LT2, although competent templates for these are present. These data suggest that the 3'-terminal initiation is a prerequisite of the production of competent transcripts and that the sequence coding for leader RNA is not, by itself, sufficient for initiation. We propose a model for the origin of this DI particle involving specific termination and resumption or replication, which is similar to that described previously for another class of DI particle RNAs.

Authors
Keene, JD; Chien, IM; Lazzarini, RA
MLA Citation
Keene, JD, Chien, IM, and Lazzarini, RA. "Vesicular stomatitis virus defective interfering particle containing a muted internal leader RNA gene." Proceedings of the National Academy of Sciences of the United States of America 78.4 II (1981): 2090-2094.
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
78
Issue
4 II
Publish Date
1981
Start Page
2090
End Page
2094

Nature of the 3'-terminal sequences of the plus and minus strands of the S1 gene of reovirus serotypes 1, 2 and 3.

Authors
Li, JK; Keene, JD; Scheible, PP; Joklik, WK
MLA Citation
Li, JK, Keene, JD, Scheible, PP, and Joklik, WK. "Nature of the 3'-terminal sequences of the plus and minus strands of the S1 gene of reovirus serotypes 1, 2 and 3." Virology 105.1 (August 1980): 41-51.
PMID
6158163
Source
pubmed
Published In
Virology
Volume
105
Issue
1
Publish Date
1980
Start Page
41
End Page
51

The plus strand of reovirus gene S2 is identical with its in vitro transcript.

Authors
Li, JK; Scheible, PP; Keene, JD; Joklik, WK
MLA Citation
Li, JK, Scheible, PP, Keene, JD, and Joklik, WK. "The plus strand of reovirus gene S2 is identical with its in vitro transcript." Virology 105.1 (August 1980): 282-286.
PMID
7414954
Source
pubmed
Published In
Virology
Volume
105
Issue
1
Publish Date
1980
Start Page
282
End Page
286

Polycistronic vesicular stomatitis virus RNA transcripts.

A procedure to enrich for the sequences present at the junction between the linked messages in the polycistronic RNAs symthesized in vitro by vesicular stomatitis virus (VSV) is described. Analyses of these sequences show that they contain a precise transcript of both the intercistronic dinucleotide and the pentanucleotide 5'--C-U-G-U-U--3', common to the 5'-end of all VSV cistrons, covalently linked to the 3'-side of the intervening poly(A). The data strongly suggest that the VSV transcriptase polyadenylylates the mRNAs and can then resume direct and precise transcription of the genome-without reinitiation and without skipping nucleotides.

Authors
Herman, RC; Schubert, M; Keene, JD; Lazzarini, RA
MLA Citation
Herman, RC, Schubert, M, Keene, JD, and Lazzarini, RA. "Polycistronic vesicular stomatitis virus RNA transcripts." Proceedings of the National Academy of Sciences of the United States of America 77.8 (1980): 4662-4665.
PMID
6254036
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
77
Issue
8
Publish Date
1980
Start Page
4662
End Page
4665

Site on the vesicular stomatitis virus genome specifying polyadenylation and the end of the L gene mRNA

The 5'-terminal nucleotide sequence from position 50 to 130 of vesicular stomatitis virus RNA was determined indirectly by using a defective interfering particle RNA which contains covalently linked genomic minus and antigenomic plus sense RNAs. The last 18 nucleotides of the L gene coding for the viral polymerase were identified and isolated by specific duplex formation between 5' terminally labeled oligonucleotides from a small single-stranded defective interfering particle RNA and L gene mRNA. The L gene ends at position 60 from the 5' terminus of the vesicular stomatitis virus genome. The data demonstrated that the first seven adenine residues in the polyadenylic acid tail of L gene mRNA may be coded for in the genome and suggested that the viral transcriptase itself may carry out polyadenylation, possibly by chattering at the uridine-rich sequence at the end of the L gene. Analysis of the 5'-terminal sequence of vesicular stomatitis virus genome RNA revealed that it might fold into a complex secondary structure with possibly 62% of the bases paired.

Authors
Schubert, M; Keene, JD; Herman, RC; Lazzarini, RA
MLA Citation
Schubert, M, Keene, JD, Herman, RC, and Lazzarini, RA. "Site on the vesicular stomatitis virus genome specifying polyadenylation and the end of the L gene mRNA." Journal of Virology 34.2 (1980): 550-559.
PMID
6246280
Source
scival
Published In
Journal of Virology
Volume
34
Issue
2
Publish Date
1980
Start Page
550
End Page
559

Intervening sequence between the leader region and the nucleocapsid gene of vesicular stomatitis virus RNA

The base sequence at the 3' end of vesicular stomatitis virus RNA was determined by using terminal labels and chemical RNA sequencing. The leader RNA was complementary to 47 bases at the 3' terminus, whereas the nucleocapsid gene (N) began 51 nucleotides from the 3' end of the genomic RNA. The intervening bases were 3'...GAAA...5' for the Indiana serotype and 3'...GAAAA...5' for the New Jersey serotype. The complements of these bases did not appear in either the leader RNA or the N mRNA. This sequence may function as a stop signal or cleavage site during transcription. Furthermore, processing or termination at this sequence must be inhibited during the production of full-length RNA plus-sense strands (replication). We recently found similar sequences approximately 46 to 48 nucleotides from the 3' ends of several defective interfering particle RNAs where the short defective interfering particle transcription products terminate. This sequence is present also at the end of the polymerase (L) gene.

Authors
Keene, JD; Schubert, M; Lazzarini, RA
MLA Citation
Keene, JD, Schubert, M, and Lazzarini, RA. "Intervening sequence between the leader region and the nucleocapsid gene of vesicular stomatitis virus RNA." Journal of Virology 33.2 (1980): 789-794.
PMID
6251249
Source
scival
Published In
Journal of Virology
Volume
33
Issue
2
Publish Date
1980
Start Page
789
End Page
794

Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved

The nucleotide sequences at the 5' and 3' termini of RNA isolated from the New Jersey serotype of vesicular stomatitis virus [VSV(NJ)] and two of its defective interfering (DI) particles have been determined. The sequence differs from that previously demonstrated for the RNA from the Indiana serotype of VSV at only 1 of the first 17 positions from the 3' terminus and at only 2 of the first 17 positions from the 5' terminus. The 5'-terminal sequence of VSV(NJ) RNA is the complement of the 3'-terminal sequence, and duplexes which are 20 bases long and contain the 3' and 5' termini have been isolated from this RNA. The RNAs isolated from DI particles of VSV(NJ) have the same base sequences as do the RNAs from the parental virus. These results are in sharp contrast to those obtained with the Indiana serotype of VSV and its DI particles, in which the 3'-terminal sequences differ in 3 positions within the first 17. However, with both serotypes, the 3'-terminal sequence of the DI RNA is the complement of the 5'-terminal sequence of the RNA from the infectious virus. These findings suggest that the 3' and 5' RNA termini are highly conserved in both serotypes and that the 3 terminus of DI RNA is ultimately derived by copying the 5' end of the VSV genome, as recently proposed.

Authors
Keene, JD; Schubert, M; Lazzarini, RA
MLA Citation
Keene, JD, Schubert, M, and Lazzarini, RA. "Terminal sequences of vesicular stomatitis virus RNA are both complementary and conserved." Journal of Virology 32.1 (1979): 167-174.
PMID
232169
Source
scival
Published In
Journal of Virology
Volume
32
Issue
1
Publish Date
1979
Start Page
167
End Page
174

A specific internal RNA polymerase recognition site of VSV RNA is involved in the generation of DI particles

The 3′ terminal sequences of four different DI particle RNAs ranging in size from 10S to 30S have been determined directly using rapid RNA sequencing methods or deduced, in the case of the fourth DI RNA, from the complementary sequence of a small RNA transcribed from this part of the genome (Schubert et al., 1978). One DI particle (DI 011) contains covalently linked genomic and antigenomic RNA. The 5′ end of this RNA is identical to that of VSV RNA, as determined by annealing for at least 1 kb, as well as to the other DI particle RNAs used in this study. The 3′ ends of the other three DI particle RNAs are exact copies of the common 5′ terminal sequence for 48 nucleotides in two cases and 45 nucleotides in the third. Beyond these complementary regions the sequences are different for each DI RNA. The fact that these regions differ in length by only three nucleotides, despite the wide differences in the overall size of the DI particle RNAs, indicates that if these DIs were formed by the copy-back mechanisms similar to those proposed by Leppert, Kort and Kolakofsky (1977) and Huang (1977), a specific recognition site for the RNA polymerase must be involved in copying the 5′ terminus. We determined the 5′ terminal sequence from position 43-48 at the end of the complementary region and found it to be 5′-GGUCUU-3′. This hexamer is also part of other highly conserved terminal RNA polymerase initiation sites (Keene et al., 1978; Keene, Schubert and Lazzarini, 1979) and may be a specific internal RNA polymerase recognition site. We conclude that this sequence is one of the elements involved in the genesis of DI particle chromosomes containing short complementary sequences at their termini. The ability of the polymerase to resume synthesis at or near a specific recognition site is discussed. © 1979.

Authors
Schubert, M; Keene, JD; Lazzarini, RA
MLA Citation
Schubert, M, Keene, JD, and Lazzarini, RA. "A specific internal RNA polymerase recognition site of VSV RNA is involved in the generation of DI particles." Cell 18.3 (1979): 749-757.
PMID
229963
Source
scival
Published In
Cell
Volume
18
Issue
3
Publish Date
1979
Start Page
749
End Page
757

The complete sequence of a unique rna species synthesized by a DI particle of VSV

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3′ terminus with 32P-cytidine 3′,5′bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5′ terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3′ terminal nucleotides of RNA fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3′ end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3′ terminal sequence among all VSV DI particles which contain part of the L gene region of the parental genome. © 1978.

Authors
Schubert, M; Keene, JD; Lazzarini, RA; Emerson, SU
MLA Citation
Schubert, M, Keene, JD, Lazzarini, RA, and Emerson, SU. "The complete sequence of a unique rna species synthesized by a DI particle of VSV." Cell 15.1 (1978): 103-112.
PMID
212197
Source
scival
Published In
Cell
Volume
15
Issue
1
Publish Date
1978
Start Page
103
End Page
112

Nucleotide sequence homology at the 3' termini of RNA from vesicular stomatitis virus and its defective interfering particles

Vesicular stomatitis virus (VSV) and defective interfering (DI) particle RNAs were labeled at their 3' ends by using RNA ligase and cytidine 3',5'-bis[32P]phosphate. The RNAs were subjected to partial digestion with alkali and analyzed by oligonucleotide fingerprinting in two dimensions. VSV and DI particle RNAs have complete sequence homology for the first eight bases from the 3' end. The following four positions contain three mismatched nucleotides in which guanosine residues in one strand are replaced by uridine residues in the other. There is again complete homology for the next five bases (positions 13-17). The locations of purine residues within the sequence were confirmed by partial digestion with RNase T1 and RNase U2 and separation by size on 20% acrylamide gels. The latter method also indicated that sequences of VSV and DI particle RNAs diverge beyond the 18th nucleotide from the 3' termini.

Authors
Keene, JD; Schubert, M; Lazzarini, RA; Rosenberg, M
MLA Citation
Keene, JD, Schubert, M, Lazzarini, RA, and Rosenberg, M. "Nucleotide sequence homology at the 3' termini of RNA from vesicular stomatitis virus and its defective interfering particles." Proceedings of the National Academy of Sciences of the United States of America 75.7 (1978): 3225-3229.
PMID
210454
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
75
Issue
7
Publish Date
1978
Start Page
3225
End Page
3229

In vitro synthesis of messenger RNA by a defective interfering particle of vesicular stomatitis virus

A defective interfering particle derived from the heat-resistant strain of vesicular stomatitis virus was analyzed for the presence of virion-associated RNA polymerase (nucleosidetriphosphate:RNA nucleotidyltransferase, EC 2.7.7.6) activity. The RNA synthesizing capacity of the defective particles in vitro was similar to that of the wild-type virus. Characterization of the RNA produced in vitro indicated that the defective particles were able to synthesize vesicular stomatitis virus leader RNA and four virus mRNA species that sediment at 12-18 S. These RNA products were identical to the mRNAs synthesized in vitro by the wild-type virus in regard to size, polyadenylation, capping, and methylation. In contrast to the wild-type virus, the purified defective particles did not synthesize the large mRNA species sedimenting at 31 S in vitro. Possible mechanisms of homotypic and heterotypic interferences shown by this defective particle are discussed.

Authors
Colonno, RJ; Lazzarini, RA; Keene, JD; Banerjee, AK
MLA Citation
Colonno, RJ, Lazzarini, RA, Keene, JD, and Banerjee, AK. "In vitro synthesis of messenger RNA by a defective interfering particle of vesicular stomatitis virus." Proceedings of the National Academy of Sciences of the United States of America 74.5 (1977): 1884-1888.
PMID
194241
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
74
Issue
5
Publish Date
1977
Start Page
1884
End Page
1888

Characterization of the 3' terminus of RNA isolated from vesicular stomatitis virus and from its defective interfering particles

The 3' termini of RNA from vesicular stomatitis virus and from three widely dissimilar defective interfering particles of the virus are PypGpU-OH. The possible relevance of these finding to autointerference and to replication of vesicular stomatitis virus is discussed.

Authors
Keene, JD; Rosenberg, M; Lazzarini, RA
MLA Citation
Keene, JD, Rosenberg, M, and Lazzarini, RA. "Characterization of the 3' terminus of RNA isolated from vesicular stomatitis virus and from its defective interfering particles." Proceedings of the National Academy of Sciences of the United States of America 74.4 (1977): 1353-1357.
PMID
193096
Source
scival
Published In
Proceedings of the National Academy of Sciences of the United States of America
Volume
74
Issue
4
Publish Date
1977
Start Page
1353
End Page
1357

A comparison of the extents of methylation of vesicular stomatitis virus messenger RNA

The 28 and 13-18 S messenger RNA classes of vesicular stomatitis virus contain the same number of methyl groups, all of which were present at the blocked 5′-ends of the molecules. This suggests that the low efficiency of translation of the 28 S mRNA relative to that of the 13 S mRNA is not due to undermethylation. © 1976.

Authors
Keene, JD; Lazzarini, RA
MLA Citation
Keene, JD, and Lazzarini, RA. "A comparison of the extents of methylation of vesicular stomatitis virus messenger RNA." Virology 69.1 (1976): 364-367.
PMID
174297
Source
scival
Published In
Virology
Volume
69
Issue
1
Publish Date
1976
Start Page
364
End Page
367
Show More